 |
 |

Mutation in the Gene Responsible for Cystic Fibrosis and Predisposition to Chronic Rhinosinusitis in the General Population
XinJing Wang, MD, PhD;
Birgitta Moylan;
Donald A. Leopold, MD;
Jean Kim, MD, PhD;
Ronald C. Rubenstein, MD, PhD;
Alkis Togias, MD;
David Proud, PhD;
Pamela L. Zeitlin, MD, PhD;
Garry R. Cutting, MD
JAMA. 2000;284:1814-1819.
ABSTRACT
 |  |
Context Chronic rhinosinusitis (CRS) is a common condition in the US general population, yet little is known about its underlying molecular cause. Chronic rhinosinusitis is a consistent feature of the autosomal recessive disorder cystic fibrosis (CF).
Objective To determine whether mutations in the cystic fibrosis transmembrane regulator (CFTR) gene, which is responsible for CF, predispose to CRS.
Design Case-control study conducted from 1996 to 1999 in which the DNA of CRS patients and controls was typed for 16 mutations that account for 85% of CF alleles in the general population. Chronic rhinosinusitis patients with 1 CF mutation were evaluated for a CF diagnosis by sweat chloride testing, nasal potential difference measurement, and DNA analysis for additional mutations.
Setting Otolaryngologyhead and neck clinic of a US teaching hospital.
Participants One hundred forty-seven consecutive adult white patients who met stringent diagnostic criteria for CRS and 123 CRS-free white control volunteers of similar age range, geographic region, and socioeconomic status.
Main Outcome Measures Presence of CF mutations by DNA analysis among CRS patients vs controls.
Results Eleven CRS patients were found to have a CF mutation ( F508, n = 9; G542X, n = 1; and N1303K, n = 1). Diagnostic testing excluded CF in 10 of these patients and led to CF diagnosis in 1. Excluding this patient from the analyses, the proportion of CRS patients who were found to have a CF mutation (7%) was significantly higher than in the control group (n = 2 [2%]; P = .04, both having F508 mutations). Furthermore, 9 of the 10 CF carriers had the polymorphism M470V, and M470V homozygotes were overrepresented in the remaining 136 CRS patients (P = .03).
Conclusion These data indicate that mutations in the gene responsible for CF may be associated with the development of CRS in the general population.
INTRODUCTION
Inflammation of the sinus epithelium is a common consequence of upper respiratory infections.1 The persistent form of this condition, chronic rhinosinusitis (CRS), is a prevalent chronic disease affecting about 14% of the US population and accounting for 11.6 million office visits in 1991.2-3 Many factors have been reported to contribute to the pathology of rhinosinusitis, but little is known of the molecular basis of this condition.2, 4 A greater understanding of the cause and pathophysiology of sinus disease at the molecular level may provide new avenues for diagnosis and therapy development.
Chronic rhinosinusitis is an almost invariable feature of cystic fibrosis (CF), one of the most common autosomal recessive disorders in whites.5 Mutations in the cystic fibrosis transmembrane regulator (CFTR) gene cause CF and a separate autosomal recessive disorder of male infertility called congenital bilateral absence of the vas deferens (CBAVD).6 Classically, CF has been diagnosed as progressive obstructive pulmonary disease, exocrine insufficiency, and male infertility accompanied by a sweat chloride concentration greater than 60 mmol/L.7-8 The phenotypic spectrum of CF is wide. For example, patients with atypical CF characterized by pulmonary disease but normal sweat chloride concentrations have been found to have mutations in both CFTR genes.9-10 It has also been suggested that mutations in CFTR may lead to nasal polyposis in otherwise healthy persons11-13 and may play a role in idiopathic pancreatitis and asthma.14-15 To determine whether CFTR plays a role in isolated rhinosinusitis in the general population, we screened CRS patients and disease-free controls enrolled by the OtolaryngologyHead and Neck Surgery Clinic of the Johns Hopkins Outpatient Center for common CF mutations.
METHODS
Patient and Control Subjects
Adult (age range, 22-75 years) white patients with nasal or sinus symptoms for more than 8 weeks2 at the time of presentation at the Johns Hopkins OtolaryngologyHead and Neck Surgery Clinic, or subjects with a history of at least 4 episodes (each >3 weeks in duration) of recurrent symptoms in the prior 12 months,2, 4 were recruited. Each patient entered into the study had evidence of thickened mucosa in the nose and/or sinuses, either by computed tomographic scan or nasal endoscopy. A family history was taken from each patient with specific reference to sinusitis, pulmonary disease, and CF.
White individuals (age range, 23-72 years) drawn from the same geographic region (Maryland and surrounding states) who had less than 10 days of signs or symptoms of rhinosinusitis per year by history or examination were enrolled as controls by the same clinic. The 123 controls included 31 patients with other conditions (eg, head and neck cancer) recruited from the same clinic as was caring for the CRS patients, 35 nonpatient volunteers from the same clinic, and 57 persons who were hospital staff. Blood relatives were identified by last name and excluded. The questionnaire used for the CRS patients was used to determine that the controls did not have CRS. Patients and controls were of similar race, age range, geographic region, and socioeconomic status (most were classified as middle class). Participation rate of controls was 98.4%.
All protocols were approved by the institutional review boards of the Johns Hopkins School of Medicine and the Johns Hopkins Bayview Medical Center, and informed consent was obtained from all subjects. As per the consent form, test results were provided to subjects on request and counseling was given on request following testing.
Analysis of CFTR Genes
Genomic DNA samples extracted from the blood of participants were screened for 16 mutations (R117H, 621 + 1G T, R334W, R347P, A455E, I507, F508, 1717-1 G A, G542X, S549N, G551D, R553X, R560T, 3849 + 10 Kb C T, W1282X, and N1303K) that account for 85% of CF alleles in the white population using the multiplex reverse dot hybridization system (Roche Molecular Systems, Alameda, Calif).16-17 This test also identified the 5T, 7T, and 9T variants of the splice acceptor site in intron 8 and F508C, I507V, and I506V (exon 10) polymorphisms of the CFTR gene.
To identify mutations other than the 16 common CF mutations, CFTR gene exons and flanking introns were analyzed using denaturing gradient gel electrophoresis (DGGE) described by Macek et al16 with the following modifications of polymerase chain reaction primers, annealing temperatures, DGGE gel gradients, and running times: exon 8, 5'-primer (GC)n TAAAGTAGATGTATAAATGC, 3'-primer ATTTTATTCGCCATTAGGAT; annealing temperature, 50°C; gradient range, 0% to 50%; running time, 15 hours; exon 9, 5'-primer TGAAAATATCTGACAAACTC, 3'-primer (GC)n CCTTCCAGCACTACAAACTA; annealing temperature, 50°C; gradient, 0% to 50%; running time, 8 hours; and exon 23, 5'-primer (GC)n CTGTTCTGTGATATTATGTG, 3'-primer GTTATCAAGAATTACAAACTA; annealing temperature, 51°C; gradient, 20% to 70%; running time, 7.5 hours.
A total of 115 DNA samples containing different mutations16 distributed over the entire coding region of CFTR were used to assess the sensitivity of the DGGE method in this study. Patient samples with an abnormal migration pattern were sequenced (ABI model 377, Applied Biosystems Inc, Foster City, Calif) at the Johns Hopkins DNA Analysis Facility. For the M470V locus, each allele was determined by restriction enzyme analysis by HphI digestion.18
Sweat Test and Nasal Potential Difference Measurement
Sweat chloride concentration was determined by quantitative pilocarpine iontophoresis by the Johns Hopkins Cystic Fibrosis Clinic as described.19-20 Nasal potential difference (NPD) measurements were performed at the Johns Hopkins Pediatric Clinical Research Unit Outpatient Center according to a published protocol21 with a few modifications.22 All perfusion solutions were at room temperature. After establishing the location of the most negative potential difference (PD) baseline during perfusion with a Ringer's solution at 0.5 mL/min, amiloride hydrochloride (10-4 mol/L) (spectrum AM 122-02) in Ringer's (pH 7.4) was applied at 5 mL/min for 2 minutes or until a stable plateau was attained. The perfusion was changed to gluconate-substituted chloride-free Ringer's solution with amiloride hydrochloride (10-4 mol/L) at 5 mL/min over the next 2 minutes or until a plateau was achieved to assess unstimulated chloride transport. This solution was then replaced with chloride-free Ringer's solution containing isoproterenol hydrochloride (10-4 mol/L) and amiloride hydrochloride (10-4 mol/L) at 5 mL/min for 3 minutes to assess cyclic adenosine monophosphateaugmented chloride transport. For data analysis, PD values are reported as those obtained at the stable plateau after perfusion of each solution.
Statistical Analysis
Comparisons of CF mutation frequencies between patient and control groups were evaluated using the Fisher exact 2-tailed test. The M470V distributions in patient and control groups were analyzed using 2 analysis. The odds ratios (ORs) were calculated using the classic case-control 2 x 2 table. The 95% confidence intervals (CIs) were calculated using the exact method. Nasal potential difference values were compared using the unpaired Student t test. A P value of .05 or less was considered significant. Statistics were calculated using SAS, version 6.12 (SAS Institute Inc, Cary, NC).
RESULTS
Screening CRS Patients for CF Mutations
Blood samples were collected from 147 white patients recruited in a sequential fashion into a prospective treatment study of CRS. Samples from a control group of 123 disease-free whites of similar age range and geographic region were collected concurrently. Eleven CRS patients were found to have CF mutations (Table 1); 9 had the common mutation, F508, 1 had G542X, and 1 had N1303K. Two F508 carriers were identified in the control group. The OR of CRS in CF allele carriers (n = 13) identified in the study was 4.9 (95% CI, 1.0-46) in comparison with noncarriers (n = 257). The 5T variant of the polypyrimidine tract in intron 8 reduces splicing efficiency of CFTR and has been associated with CBAVD.6, 23 However, there was no statistically significant difference in the frequency of the 5T variant between patients and controls, and none of the CF mutation carriers had the 5T variant. Among 147 CRS patients and 123 controls, 1 patient reported a family history of CF (first cousin). This patient did not have an identified CF mutation.
|
|
|
|
Table 1. Cystic Fibrosis (CF) Mutations and Cystic Fibrosis Transmembrane Regulator (CFTR) Variants in Chronic Rhinosinusitis (CRS) Patients and Controls*
|
|
|
To determine whether any patients had mutations other than the 16 common CF mutations, the DNA of patients having 1 CF mutation or the 5T variant was analyzed by DGGE and sequencing. Using this technique, we previously demonstrated that at least 96% of mutations in the exons and flanking intron regions of the CFTR gene can be detected.16 A 97% sensitivity was achieved using 115 samples with previously identified mutations16 in this study. Sequence analysis of samples with an abnormal DGGE pattern identified an R75Q mutation in the N1303K carrier and an L967S mutation in the G542X carrier. Neither R75Q or L967S is a CF-causing mutation (Cystic Fibrosis Mutation Data Base, http://www.genet.sickkids.on.ca/cftr/). A second CF-causing mutation (2789 + 5G A) was found in patient 1624 (Table 1).
Nine of the 10 CRS patients (patient 1624 was excluded because of having been diagnosed as having CF) having a CF mutation also had valine at codon 470 rather than methionine (M470V) (Table 1). The M470V variant does not cause CF, but CFTR with valine functions differently from wild-type CFTR with methionine at codon 470.18, 24 In 8 cases, pedigree analysis or DNA sequencing confirmed that the M470V variant was in the other CFTR gene (Table 1). Seven of the 8 patients had F508 and M470V, which both occur on exon 10; thus, sequencing from each direction can identify whether they occur together. Patient 1386 had changes in exon 10 (M470V), exon 15 (L967S), and exon 11 (G542X), and pedigree analysis was used to show that the M470V variant and the L967S variant segregated independently of G542X. Neither of the F508 carriers in the control group carried the M470V allele. To further explore the possible role of this variant in rhinosinusitis, we analyzed the entire remaining (those not having a CF mutation) patient group and control group (Table 1). The frequency of the M470V allele was higher in the CRS group (61%) than the control group (53%) and higher than the published frequency of this allele in the general population (50%).25 The distribution of M470V genotypes differed significantly between the 2 groups (P = .03) due to an excess of M470V homozygotes (Table 1). The OR of CRS in M470V homozygotes was 2.0 (95% CI, 1.2-3.3).
In Vivo Evaluation of CFTR Function in CF Mutation Carriers
Cystic fibrosis transmembrane regulator function in the sweat gland of patients having CF mutations was evaluated by determination of sweat chloride concentration and in nasal epithelia via measurement of NPD. One patient (No. 1600) decided not to continue the study and did not have sweat testing or NPD analysis. The patient having 2 CF mutations (No. 1624) had an elevated sweat chloride concentration (102 mmol/L) (normal level, <60 mmol/L).20 The N1303K carrier patient (No. 1344) had 2 borderline and 1 elevated sweat chloride concentration measurements (55, 58, and 78 mmol/L), while the remaining patients had values in the normal range (Table 2).
|
|
|
|
Table 2. Cystic Fibrosis Transmembrane Regulator (CFTR) Genotypes and Clinical Features of Chronic Rhinosinusitis Patients Having a Cystic Fibrosis Mutation*
|
|
|
The baseline PD in nasal epithelia reflects ongoing sodium reabsorption and is elevated 2-fold in CF. Patient 1624 had an elevated baseline value (-29 mV), which was in the range of that of previously studied CF patients22 (Table 3). The remaining CRS patients had values well below those in the CF range (Table 3). Inhibition of sodium reabsorption by amiloride hydrochloride lowers the PD, although the change is typically greater in CF patients than in persons not having CF.21 While the amiloride hydrochloride response of patient 1624 (change in PD [ PD] = 21.1 mV) was in the range of that of the CF patients, the remaining CRS patients had a mean PD that was similar to that of persons not having CF (Table 3). The most discriminating feature of the NPD for CF is the PD in response to perfusion with a chloride-free solution containing amiloride hydrochloride and isoproterenol hydrochloride.21, 26 The mean (SD) PD for persons not having CF was -15.8 (6) mV, whereas CF patients and CRS patient 1624 had no such response to this maneuver ( PD = 2.4 mV). The mean (SD) PD for the remaining CRS patients with 1 CF mutation (-11[7.1] mV) was significantly different from the mean PD of the CF patients (P<.001).
|
|
|
|
Table 3. Potential Difference (PD) Measurements of Nasal Epithelia in Chronic Rhinosinusitis (CRS) Patients Having Cystic Fibrosis (CF) Mutations*
|
|
|
COMMENT
Chronic rhinosinusitis is a common disorder that is likely to have a number of different causes.2 The prominence of sinus disease in certain inherited conditions suggests that genetic factors may play a role in CRS.27 To pursue this concept, we screened patients with CRS for mutations in the CFTR gene. The CFTR gene is a reasonable candidate since sinusitis is a consistent feature of CF.28 We initiated our CF mutation analysis in white patients because they accounted for most CRS patients visiting our clinic and the frequencies of CF alleles have been extensively studied in whites.29 Screening for the common CF mutations identified 11 mutation carriers among 147 CRS patients. Since this number of carriers was higher than expected, we had to exclude the possibility that the excess was due to patients with mild CF presenting with sinus disease.
Newly updated guidelines for the diagnosis of CF require 1 clinical manifestation characteristic of CF and evidence of CFTR dysfunction in the sweat gland or nasal epithelia or molecular evidence at the DNA level.30 All 11 patients had radiographic evidence of sinus disease, one of the phenotypic features consistent with CF. Only 1 patient with CRS (No. 1624) had consistent evidence of CFTR dysfunction in vivo (elevated sweat chloride concentration [102 mmol/L], and abnormal NPD); this patient had 2 CF-causing mutations ( F508 and 2789 + 5G A) and was diagnosed as having CF at 46 years of age. After excluding the single CF patient, the CRS group had 10 CF mutation carriers, a significant excess compared with the control group (P = .04). Based on a CF carrier rate of 1 in 28 (0.036) in the general population29 and a test sensitivity of 85%, we expected 3 or 4 carriers in the control group. However, only 2 CF carriers were identified among 123 controls. Because the number of expected carriers was small, it is not clear whether CF carrier frequency in the disease-free controls differs from that of the general population. However, if the OR of CRS in CF carriers is about 5-fold higher than in the general population, it is possible that the sinus disease-free population could have a lower CF carrier frequency.
Most of the CF carriers with CRS had variants in their other CFTR gene. An analogous situation occurs in patients with CBAVD. A substantial fraction of patients with CBAVD have 2 mutations; one that is observed in CF patients and a second that is a variant not associated with CF.31 The interpretation at the biochemical level is that the second mutation permits CFTR to function sufficiently to escape the CF phenotype, but some epithelial tissue dysfunction does occur. Indeed, in addition to CRS, patient 1344 had subtle sweat gland dysfunction and a history of bronchitis while patient 1386 had sputum infected with Pseudomonas aeruginosa, an organism common in CF patients but unusual in the general population.7 Both patients were found to carry mutations that are not associated with CF (R75Q and L967S). Furthermore, the M470V variant was found in 9 of the 10 CRS patients with a CF mutation, and homozygotes for M470V were in significant excess in the remaining CRS patients. It is interesting to note that patients having a CF mutation that eliminates function and the M470V variant are similar at the cellular level to M470V homozygotes; only CFTR with the M470V variant is functional in their cells.18 Since the chloride channel activity of CFTR with valine at codon 470 is reduced compared with CFTR with methionine at codon 470, it is tempting to speculate that CFTR dysfunction due to M470V predisposes certain individuals to CRS.
We screened for 16 CFTR mutations (of the >900 mutations reported on the Cystic Fibrosis Mutation Data Base [http://www.genet.sickkids.on.ca/cftr/]), accounting for 85% of CF alleles in whites. An underestimate would be 15% at most; thus, 1 or 2 CRS patients in our study may have rare CF alleles undetected by the standard panel. To identify them, the CFTR genes of all patients would have to be analyzed, a substantial amount of work infeasible in a clinical setting. If certain rare CF alleles occurred only in CRS patients, they should have been found in combination with common CF alleles in the 22 CRS patients (11 CF allele carriers and 11 5T carriers) for whom the entire CFTR gene was screened.
How might CFTR dysfunction contribute to development of CRS? The importance of CFTR to the normal function of the sinus epithelium is illustrated by CF. Severe reduction in CFTR function observed in CF patients leads to chronic sinus disease that usually begins early in childhood. Therefore, it seems reasonable that less severe reductions in CFTR function may be associated with CRS in the absence of CF. The inability of NPD measurements to identify reduced CFTR function in the CRS patients with CF mutations is not surprising. This test has been developed and refined to distinguish CF from other disorders and does not discriminate a CF carrier from a person not having CF mutations.21 It is possible that consequences of altered CFTR function may be manifested only under stress, such as an acute upper respiratory infection. Altered viscosity and abnormal electrolyte composition of sinus secretions due to CFTR dysfunction may increase the chance that rhinosinusitis will progress to a chronic phase. The presence of other genetic factors and/or specific environmental exposures may also increase the likelihood that persons with reduced CFTR function eventually develop CRS. While only a minor fraction of CRS patients in this study had CF mutations, our observation provides fresh molecular insight into a common chronic disorder and suggests new avenues of investigation.
AUTHOR INFORMATION
Financial Disclosure: Dr Kim owns stock in Amgen, Immunex, Pfizer, and Schering-Plough. Dr Zeitlin received research grantsfrom the Cystic Fibrosis Foundation, National Heart, Lung, and Blood Institute, MoliChem Medicines, Inc, Intrabiotics, and MedImmune and a lecture sponsorship from Pathogenesis Corporation. Dr Togias received research grants or funding or lecture sponsorship from or consulted for Schering-Plough, Protein Design Laboratories, Novartis/Genentech, Glaxo Wellcome, Merck, Pfizer, and Astra-Zeneca. Dr Cutting owns stock in Invitrogen and Life Technologies and consulted for Roche Molecular Systems.
Funding/Support: This work was funded by grants from the National Institute of Allergy and Infectious Diseases (Drs Leopold, Togias, Proud, and Cutting), the National Institute of Diabetes and Digestive and Kidney Diseases (Dr Cutting), the Cystic Fibrosis Foundation (Drs Rubenstein and Zeitlin), and Clinical Research Center grant NIH RR00052 (Dr Zeitlin). Reagents for the Multiplex Reverse Hybridization System test for cystic fibrosis mutations were provided by Roche Molecular Systems.
Acknowledgment: The authors wish to thank Michael Boyle, MD, and Lois Brass-Ernst, RN, for assistance with NPD measurements; Ada Hamosh, MD, MPH, Rita McWilliams, MPH, and Terri Beaty, PhD, for statistical advice; the Johns Hopkins General Clinical Research Unit; and Trisha Cornwall for secretarial assistance.
Corresponding Author and Reprints: Garry R. Cutting, MD, McKusick-Nathans Institute of Genetic Medicine, CMSC 1004, Baltimore, MD 21287 (e-mail: gcutting{at}jhmi.edu).
Author Affiliations: McKusick-Nathans Institute of Genetic Medicine (Drs Wang and Cutting), Department of Medicine (Drs Togias and Proud and Ms Moylan), Department of OtolaryngologyHead and Neck Surgery (Drs Leopold and Kim), and Department of Pediatrics (Drs Rubenstein, Zeitlin, and Cutting), Johns Hopkins University School of Medicine, Baltimore, Md. Dr Rubenstein is now affiliated with the Department of Pulmonary Medicine, Children's Hospital of Philadelphia, Philadelphia, Pa.
REFERENCES
 |  |
1. Gwaltney JM Jr, Phillips CD, Miller RD, Riker DK. Computed tomographic study of the common cold. N Engl J Med. 1994;330:25-30.
FREE FULL TEXT
2. Kaliner MA, Osguthorpe JD, Fireman P, et al. Sinusitis: bench to bedside. Current findings, future directions. J Allergy Clin Immunol. 1997;99(6, pt 3):S829-S848.
3. Collins JG. Prevalence of selected chronic conditions: United States, 1986-88. Vital Health Stat 10. 1993;(182):1-87.
4. International Rhinosinusitis Advisory Board. Infectious rhinosinusitis in adults: classification, etiology and management. Ear Nose Throat J. 1997;76(12 suppl):1-22.
5. Ledesma-Medina J, Osman MZ, Girdany BR. Abnormal paranasal sinuses in patients with cystic fibrosis of the pancreas. Pediatr Radiol. 1980;9:61-64.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
6. Chillón M, Casals T, Mercier B, et al. Mutations in the cystic fibrosis gene in patients with congenital absence of the vas deferens. N Engl J Med. 1995;332:1475-1480.
FREE FULL TEXT
7. Welsh MJ, Tsui LC, Boat TF, Beaudet AL. Cystic fibrosis. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The Metabolic and Molecular Bases of Inherited Disease. New York, NY: McGraw-Hill Inc; 1995:3799-3876.
8. Cutting GR. Cystic fibrosis. In: Rimoin DL, Connor JM, Pyeritz RD, eds. Emery and Rimoin's Principles and Practice of Medical Genetics. London, England: Churchill-Livingston; 1997:2685-2717.
9. Strong TV, Smit LS, Turpin SV, et al. Cystic fibrosis gene mutation in two sisters with mild disease and normal sweat electrolyte levels. N Engl J Med. 1991;325:1630-1634.
WEB OF SCIENCE
| PUBMED
10. Highsmith WE, Burch LH, Zhou Z, et al. A novel mutation in the cystic fibrosis gene in patients with pulmonary disease but normal sweat chloride concentrations. N Engl J Med. 1994;331:974-980.
FREE FULL TEXT
11. Burger J, Macek M Jr, Stuhrmann M, et al. Genetic influences in the formation of nasal polyps. Lancet. 1991;337:974.
PUBMED
12. Varon R, Magdorf K, Staab D, et al. Recurrent nasal polyps as a monosymptomatic form of cystic fibrosis associated with a novel in-frame deletion (591del18) in the CFTR gene. Hum Mol Genet. 1995;4:1463-1464.
FREE FULL TEXT
13. Irving RM, McMahon R, Clark R, Jones NS. Cystic fibrosis transmembrane conductance regulator gene mutations in severe nasal polyposis. Clin Otolaryngol. 1997;22:519-521.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
14. Cohn JA, Friedman KJ, Noone PG, et al. Relation between mutations of the cystic fibrosis gene and idiopathic pancreatitis. N Engl J Med. 1998;339:653-658.
FREE FULL TEXT
15. Lazaro C, de Cid R, Sunyer J, et al. Missense mutations in the cystic fibrosis gene in adult patients with asthma. Hum Mutat. 1999;14:510-519.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
16. Macek M Jr, Mercier B, Macková A, et al. Sensitivity of the denaturing gradient gel electrophoresis technique in detection of known mutations and novel Asian mutations in the CFTR gene. Hum Mutat. 1997;9:136-147.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
17. Kawasaki E, Saiki R, Erlich H. Genetic analysis using polymerase chain reaction-amplified DNA and immobilized oligonucleotide probes: reverse dot-blot typing. Methods Enzymol. 1993;218:369-381.
WEB OF SCIENCE
| PUBMED
18. Cuppens H, Lin W, Jaspers M, et al. Polyvariant mutant cystic fibrosis transmembrane conductance regulator genes: the polymorphic (Tg)m locus explains the partial penetrance of the 5T polymorphism as a disease mutation. J Clin Invest. 1998;101:487-496.
WEB OF SCIENCE
| PUBMED
19. Gibson LE, Cooke RE. A test for concentration of electrolytes in sweat in cystic fibrosis of the pancreas utilizing pilocarpine by iontophoresis. Pediatrics. 1959;23:545-549.
FREE FULL TEXT
20. LeGrys VA, Burritt MF, Gibson LE, et al. Sweat Testing: Sample Collection and Quantitative Analysis: Approved Guideline. Villanova, Pa: NCCLS; 1994.
21. Knowles MR, Paradiso AM, Boucher RC. In vivo nasal potential difference: techniques and protocols for assessing efficacy of gene transfer in cystic fibrosis. Hum Gene Ther. 1995;6:445-455.
WEB OF SCIENCE
| PUBMED
22. Rubenstein RC, Zeitlin PL. A pilot clinical trial of oral sodium 4-phenylbutyrate (Buphenyl) in deltaF508-homozygous cystic fibrosis patients. Am J Respir Crit Care Med. 1998;157:484-490.
FREE FULL TEXT
23. Chu CS, Trapnell BC, Curristin S, et al. Genetic basis of variable exon 9 skipping in cystic fibrosis transmembrane conductance regulator mRNA. Nat Genet. 1993;3:151-156.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
24. Kerem BS, Zielenski J, Markiewicz D, et al. Identification of mutations in regions corresponding to the two putative nucleotide (ATP)-binding folds of the cystic fibrosis gene. Proc Natl Acad Sci U S A. 1990;87:8447-8451.
FREE FULL TEXT
25. Cuppens H, Teng H, Raeymaekers P, et al. CFTR haplotype backgrounds on normal and mutant CFTR genes. Hum Mol Genet. 1994;3:607-614.
FREE FULL TEXT
26. Knowles MR, Carson JL, Collier AM, et al. Measurements of nasal transepithelial electric potential differences in normal human subjects in vivo. Am Rev Respir Dis. 1981;124:484-490.
WEB OF SCIENCE
| PUBMED
27. Cutting GR. Genetics of rhinosinusitis. In: Kennedy DW, Zinreich SJ, eds. Diseases of the Sinuses: Diagnostic and Endoscopic Management. Hamilton, Ontario: BC Decker; 2000.
28. Ramsey B, Richardson MA. Impact of sinusitis in cystic fibrosis. J Allergy Clin Immunol. 1992;90(3, pt 20):547-552.
29. Hamosh A, Fitz-Simmons SC, Macek M Jr, et al. Comparison of the clinical manifestations of cystic fibrosis in black and white patients. J Pediatr. 1998;132:255-259.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
30. Rosenstein BJ, Cutting GR. The diagnosis of cystic fibrosis: a consensus statement. J Pediatr. 1998;132:589-595.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
31. Mak V, Zielenski J, Tsui LC, et al. Proportion of cystic fibrosis gene mutations not detected by routine testing in men with obstructive azoospermia. JAMA. 1999;281:2217-2224.
FREE FULL TEXT
CiteULike Connotea Del.icio.us Digg Reddit Technorati Twitter
What's this?
RELATED ARTICLES
October 11, 2000
JAMA. 2000;284(14):1863-1864.
EXTRACT
| FULL TEXT
Cystic Fibrosis
JAMA. 2000;284(14):1884.
PDF
THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES
 |
Heterozygosity for a Single Mutation in the ABCC6 Gene May Closely Mimic PXE: Consequences of This Phenotype Overlap for the Definition of PXE
Martin et al.
Arch Dermatol 2008;144:301-306.
ABSTRACT
| FULL TEXT
Prospective analysis of cystic fibrosis transmembrane regulator mutations in adults with bronchiectasis or pulmonary nontuberculous mycobacterial infection.
Ziedalski et al.
Chest 2006;130:995-1002.
ABSTRACT
| FULL TEXT
Mutations in the Cystic Fibrosis Transmembrane Regulator Gene and In Vivo Transepithelial Potentials
Wilschanski et al.
Am. J. Respir. Crit. Care Med. 2006;174:787-794.
ABSTRACT
| FULL TEXT
Increased prevalence of interleukin-1 receptor antagonist gene polymorphism in patients with chronic rhinosinusitis.
Cheng et al.
Arch Otolaryngol Head Neck Surg 2006;132:285-290.
ABSTRACT
| FULL TEXT
A Haplotype Framework for Cystic Fibrosis Mutations in Iran
Elahi et al.
J. Mol. Diagn. 2006;8:119-127.
ABSTRACT
| FULL TEXT
ABCA3 Mutations Associated with Pediatric Interstitial Lung Disease
Bullard et al.
Am. J. Respir. Crit. Care Med. 2005;172:1026-1031.
ABSTRACT
| FULL TEXT
Dynamic Activation of Cystic Fibrosis Transmembrane Conductance Regulator by Type 3 and Type 4D Phosphodiesterase Inhibitors
Liu et al.
J. Pharmacol. Exp. Ther. 2005;314:846-854.
ABSTRACT
| FULL TEXT
Chloride Transport in Nasal Ciliated Cells of Cystic Fibrosis Heterozygotes
Sermet-Gaudelus et al.
Am. J. Respir. Crit. Care Med. 2005;171:1026-1031.
ABSTRACT
| FULL TEXT
Increased Prevalence of Chronic Rhinosinusitis in Carriers of a Cystic Fibrosis Mutation
Wang et al.
Arch Otolaryngol Head Neck Surg 2005;131:237-240.
ABSTRACT
| FULL TEXT
Establishing a diagnosis of cystic fibrosis
Southernl and Peckham
Chronic Respiratory Disease 2004;1:205-210.
ABSTRACT
Clinical Manifestations of Cystic Fibrosis Among Patients With Diagnosis in Adulthood
Gilljam et al.
Chest 2004;126:1215-1224.
ABSTRACT
| FULL TEXT
Interleukin 8 Secretion from Monocytes of Subjects Heterozygous for the {Delta}F508 Cystic Fibrosis Transmembrane Conductance Regulator Gene Mutation Is Altered
Zaman et al.
CVI 2004;11:819-824.
ABSTRACT
| FULL TEXT
Association of Cystic Fibrosis with Abnormalities in Fatty Acid Metabolism
Freedman et al.
NEJM 2004;350:560-569.
ABSTRACT
| FULL TEXT
Pathophysiology and Management of Pulmonary Infections in Cystic Fibrosis
Gibson et al.
Am. J. Respir. Crit. Care Med. 2003;168:918-951.
ABSTRACT
| FULL TEXT
A haplotype-based molecular analysis of CFTR mutations associated with respiratory and pancreatic diseases
Lee et al.
Hum Mol Genet 2003;12:2321-2332.
ABSTRACT
| FULL TEXT
Chronic pancreatitis and cystic fibrosis
Witt
Gut 2003;52:ii31-41.
ABSTRACT
| FULL TEXT
Population Screening in the Age of Genomic Medicine
Khoury et al.
NEJM 2003;348:50-58.
FULL TEXT
Variant Cystic Fibrosis Phenotypes in the Absence of CFTR Mutations
Groman et al.
NEJM 2002;347:401-407.
ABSTRACT
| FULL TEXT
|