 |
 |

Prevalence of C282Y and H63D Mutations in the Hemochromatosis (HFE) Gene in the United States
Karen K. Steinberg, PhD;
Mary E. Cogswell, DrPH;
Joy C. Chang, PhD;
Samuel P. Caudill, PhD;
Geraldine M. McQuillan, PhD;
Barbara A. Bowman, PhD;
Laurence M. Grummer-Strawn, DrPH;
Eric J. Sampson, PhD;
Muin J. Khoury, MD,PhD;
Margaret L. Gallagher, PhD
JAMA. 2001;285:2216-2222.
ABSTRACT
 |  |
Context Population-based estimates of the prevalence of disease-associated mutations, such as hemochromatosis (HFE) gene mutations, are needed to determine the usefulness of genetic screening.
Objective To estimate the prevalence of the HFE mutations C282Y and H63D in the US population.
Design Cross-sectional population-based study of samples in the DNA bank from phase 2 of the Third National Health and Nutrition Examination Survey conducted from 1992 to 1994.
Setting and Participants Genotyped samples of cells from a total of 5171 participants, cross-classified by sex, age, and race/ethnicity in the analysis.
Main Outcome Measures Estimates of the prevalence of C282Y and H63D mutations.
Results The prevalence of C282Y homozygosity is estimated to be 0.26% (95% confidence interval [CI], 0.12%-0.49%); 1.89% (95% CI, 1.48%-2.43%) for H63D homozygosity; and 1.97% (95% CI, 1.54%-2.49%) for compound heterozygosity. The prevalence estimates for C282Y heterozygosity (C282Y/wild type) are 9.54% among non-Hispanic whites, 2.33% among non-Hispanic blacks, and 2.75% among Mexican-Americans. The prevalence estimates of the C282Y mutation in the US population are 5.4% (95% CI, 4.7%-6.2%) and 13.5% (95% CI, 12.5%-14.8%) for the H63D mutation.
Conclusions Estimates of prevalence of HFE mutations are within the expected range for non-Hispanic whites and blacks but the estimated prevalence of the C282Y mutation among Mexican-Americans is less than expected. Mutation data now need to be linked to clinically relevant indices, such as transferrin saturation level.
INTRODUCTION
Now that the human genome has been sequenced, and as scientists elucidate the location and function of all human genes, public health policymakers face the daunting task of making complex decisions about the appropriateness and usefulness of genetic screening. To make such decisions, they will first need population-based estimates of the prevalence and penetrance of these mutations. Hereditary hemochromatosis (HH), a major form of iron overload disease, can serve as a model for making such decisions.
Hereditary hemochromatosis is a disorder of iron metabolism in which excess iron absorption leads to deposition of iron in multiple organs, resulting in cirrhosis, diabetes, cardiomyopathy, or hypogonadism, and can lead to early death.1 Hemochromatosis is one of the most common autosomal recessive disorders among whites in the United States. The estimated prevalence is between 1 in 200 and 1 in 500 individuals in screening studies conducted among patients in primary care settings, employed individuals, blood donors, and other groups in which case definitions are based on elevated levels of iron.2 A presumptive diagnosis of hemochromatosis is based on elevated fasting transferrin saturation levels.3 When predisposition to iron overload is identified early in the course of disease, organ failure can be prevented by periodic phlebotomy.4
The hemochromatosis gene (HFE) has been localized to the short arm of chromosome 6 and has been identified as a major histocompatibility complex class I-like gene.5 Recent evidence shows that the protein coded for by HFE binds to the transferrin receptor and reduces its affinity for iron-bound transferrin.6-8 Two missense mutations in HFE, denoted C282Y and H63D, account for most cases of HH among individuals of European descent.5, 9-13 Homozygosity for the C282Y mutation accounts for an estimated 50% to 100% of HH cases.5, 9-13 Although the true prevalence remains unknown, 10% of the US population is estimated to be heterozygous for the C282Y mutation, which can be associated with increased levels of transferrin saturation, but which is only rarely associated with liver damage.14-16 A small percentage of cases of HH are attributable to the C282Y/H63D compound heterozygous state, which is estimated to have a prevalence rate of 1.4% to 2.4% in populations of European descent.16-18 Homozygosity for the H63D mutation has been associated with a significantly increased risk for phenotypic expression of hemochromatosis (odds ratio, 9.0; 95% confidence interval [CI], 1.7-47).9, 16
No study has provided a true estimate of the prevalence of the 2 mutations within the US population. Previous prevalence estimates were derived from small, nonrepresentative US samples, such as employed individuals (n = 1653), or individuals recruited as control subjects in studies comparing them with patients with hemochromatosis (sample sizes ranged from 142-384).4, 8, 16, 19 In addition, none of these studies included a large sample of individuals from minority groups.
To obtain an estimate of the prevalence of the C282Y and H63D mutations in the US population, we genotyped 5171 specimens from a nationally representative sample derived from the Third National Health and Nutrition Examination Survey (NHANES III) DNA bank.20 We then examined the prevalence of the 2 mutations by race/ethnicity, sex, and age. Ours is the first study using this nationally representative sample to estimate the prevalence of disease-associated mutations.
METHODS
Survey Design and Participants
NHANES is a series of national surveys that the National Center for Health Statistics began conducting in 1966. Among its several objectives, NHANES data are used to estimate the national prevalence of common diseases and risk factors for those diseases in the US population. As part of NHANES III, which was conducted in 2 phases from 1988 through 1994,21-22 certain populations, including non-Hispanic blacks and Mexican Americans, were oversampled. Both phase 1 and phase 2 were nationally representative. Prevalence estimates were weighted to account for oversampling and nonresponse to the household interview and the examination.
Cell lines from 8205 participants in phase 2 of NHANES III (1992-1994) were immortalized with Epstein-Barr virus. Although the Centers for Disease Control and Prevention planned to collect DNA for storage, the decision to establish cell lines occurred after phase 1 had already begun. Overall, 15 946 individuals aged 12 years or older (who did not list "other" as race/ethnicity) were selected as part of phase 2. A total of 13 012 (81.6%) were interviewed, 11 960 (75.2%) were examined, and cell lines were available for 8205 (69%) of examined individuals. All estimates are weighted to represent the total US population and to account for oversampling and nonresponse to the household interview and physical examination. The sample for genotyping included phase 2 participants who were 12 years or older, who were not pregnant, and who did not have "other" listed for race/ethnicity. Because this sample was also used to study associations between total iron-binding capacity (transferrin saturation) level and HFE genotype (a study still in progress), we excluded participants for whom transferrin values were missing (3.7%). Serum iron and serum ferritin levels were also obtained (in addition to transferrin saturation levels, these data are not reported herein). To ensure that previously masked specimens, which had been given new identification numbers, remained anonymous (ie, no one could link an HFE genotype to a personal identifier in the full NHANES data set), it was necessary to guarantee that no fewer than 5 individuals had the same set of background characteristics (age, sex, race/ethnicity). These common characteristics constituted a sampling cell. Of the individuals within a sampling cell who did have a common set of background characteristics, we randomly eliminated 20% or 2 of the subjects, whichever number was larger. Two additional specimens could not be amplified for genotyping, making the final sample size 5171.
An institutional review board at the National Center for Health Statistics approved the survey as well as the specific analysis done for this report. All participants gave written informed consent for the survey. Principles involved in consideration of research on the samples are represented in a previous publication.23 The specimens were masked, irrevocably destroying the ability to link HFE genotype to individual participants, because informed consent did not expressly mention genetic studies (at the time the survey was planned, there were no specific tests planned that could be described to participants and the institutional review board felt that a discussion of DNA would not be helpful to participants). Also, the penetrance and clinical significance of HFE mutations have yet to be established. Finally, study participants were made aware of abnormalities in results of testing (all participants in NHANES III were notified regarding serum ferritin levels, although it is possible that they could have had HFE mutations without altered iron indices).
Genotyping Methods
Specimens were genotyped in the Molecular Biology Branch of the Division of Laboratory Sciences, National Center for Environmental Health, Centers for Disease Control and Prevention, using genomic DNA extracted from Epstein-Barr virustransformed cell lines. The wild type (WT) and C282Y and H63D mutations were genotyped using TaqMan technology24-26 in which amplification and genotyping are simultaneously performed using the ABI PRISM 7700 (Applied Biosystems, Foster City, Calif).
Separate polymerase chain reactions were performed for C282Y and H63D sites using primers and probes that were designed using Primer Express (Applied Biosystems) based on published sequences. The H63D site sequences used were as follows: forward primer, 5'TCTTTCCTTGTTTGAAGCTTTGG; reverse primer, 5'TCCCACCCTTTCAGACTCTGA; WT probe, 5' FAM CACGGCGACTCTCATGATCATAGAACAC; mutant probe, 5' VICCACGGCGACTCTCATCATCATAGAACAC. The C282Y site sequences were: forward primer, 5'GGCTGGATAACCTTGGCTGTAC; reverse primer, 5'TCACATACCCCAGATCACAATGA; WT probe, 5' FAM TGCTCCACCTGGCACGTATATCTCTG; mutant probe, 5' VIC TGCTCCACCTGGTACGTATATCTCTGCTC.
Discrimination between alleles was accomplished by running allelic discrimination using ABI PRISM 7700, following the manufacturer's protocol. In addition, all allele calls were confirmed by visual inspection of the results of the multicomponent analysis of the real-time polymerase chain reaction. We randomly selected approximately 5% of the specimens for genotype confirmation using the restriction fragment-length polymorphism method described by Lynas.27 In addition, we confirmed all samples with the C282Y/C282Y genotype. Genotype calls, as determined by the restriction fragment-length polymorphism method, were 100% concordant with genotype calls obtained by TaqMan polymerase chain reaction analysis.
Statistical Analysis
NHANES III was designed so that both phase 1 and phase 2 would be national probability samples. Prevalence estimates are weighted to give an estimate representing the US population.22 Weighting accounts for oversampling of non-Hispanic black and Mexican American populations, probability of selection, noncoverage, and nonresponse. For each sample cell, we determined average weights and assigned them to each individual in that cell. The average weights were used to calculate the weighted prevalence estimates using SAS software (SAS Institute Inc, Cary, NC).28 We computed weighted prevalence estimates of HFE mutations in the population by determining the appropriate functions that relate allele frequency to genotype frequencies and then applying the average weights, as before, using SAS. For example, to compute the weighted prevalence estimate for the C282Y mutation, we determined the weighted estimate of the variable C282Y using the following definitions: C282Y = (2 x C282_HO + C282_HE + C282_H6)/2 in which C282_HO is the NHANES III variable corresponding to the homozygous C282Y/C282Y genotype, C282_HE is the variable corresponding to the heterozygous C282Y/WT genotype, and C282_H6 is the variable corresponding to the compound heterozygous C282Y/H63D genotype.
We were unable to calculate SEs accounting for the complex sample design because anonymity requirements prevented access to cluster variables. Therefore, to account for the complex sampling design, we used the binomial distribution to construct approximate CIs for the weighted estimates using sample sizes determined by dividing actual sample sizes by an assumed design effect of 1.5. In reality, the design effect for this analysis may be lower or higher than 1.5. Random selection within strata, for example, tends to lower the design effect.29
Using an average design effect of 1.5, we found that genotypes from 2454 participants would be required to ensure 80% power to estimate a mean (SE) prevalence of 0.4% (0.2%), which was the expected prevalence of homozygosity. At least 354 participants would be needed to estimate a 10% (2.5%) prevalence, which was the expected prevalence of C282Y/WT heterozygosity.
We randomly selected 5171 specimens for study from participant cells cross-classified by sex, age, race/ethnicity, and transferrin saturation level. When weighted properly, these specimens should be representative of the US population.
RESULTS
Based on our results, homozygosity for the C282Y mutation was estimated to occur in 0.26% (95% CI, 0.12%-0.49%) of the total US population, and compound heterozygosity (C282Y/H63D) in approximately 2% (Table 1). Among WT heterozygous genotypes (C282Y/WT and H63D/WT), the genotype H63D/WT was about 2.5-fold more common than the genotype C282Y/WT. Homozygosity for the H63D mutation was estimated to occur in 1.89% (95% CI, 1.48%-2.43%) of the total US population.
|
|
|
|
Table 1. Estimated Prevalence of Hemochromatosis (HFE) Genotypes in the US Population by Race/Ethnicity*
|
|
|
When we estimated prevalence of genotypes by ethnic group, we found that the estimate for the C282Y/C282Y genotype was 5- to 10-fold higher in non-Hispanic whites than in Mexican Americans or non-Hispanic blacks (Table 1). The CIs for prevalence estimates for C282Y/C282Y overlapped among the 3 groups, but the estimates were made on the basis of only 1 person each in the Mexican American and non-Hispanic black groups. The estimated prevalence for the H63D/H63D genotype was highest among non-Hispanic whites and lowest among non-Hispanic blacks, with estimates for Mexican Americans falling between the 2 previous groups. However, differences among the groups were statistically significant only between non-Hispanic blacks and non-Hispanic whites. Prevalence estimates for compound heterozygotes (C282Y/H63D) were also significantly higher for non-Hispanic whites than for the other groups. Although the C282Y/WT genotype was estimated to be significantly more common in non-Hispanic whites than in other groups, non-Hispanic whites and Mexican Americans had similar prevalence estimates for the H63D/WT genotype, and both of these groups had significantly higher prevalence estimates for H63D/WT than did non-Hispanic blacks.
Calculations using these genotype frequency data indicated that the C282Y mutation is estimated to be present in 5.4% of the total US population and the H63D mutation in 13.5% (Table 2). These percentages are slightly higher when data from the non-Hispanic white population are used in separate calculations.
|
|
|
|
Table 2. Estimated Prevalence of Hemochromatosis (HFE) Mutations in US Population
|
|
|
We found no significant differences in prevalence estimates for genotypes between men and women when ethnic groups were combined (Table 3). For all genotypes, CIs around the estimates for men and women overlapped. Although there were generally no differences in prevalence of genotype by age, these estimates are based on a small number of individuals, as only 3 individuals younger than 60 years had the C282Y/C282Y genotype (Table 4).
|
|
|
|
Table 3. Estimated Prevalence of Hemochromatosis (HFE) Genotypes in the US Population by Sex*
|
|
|
|
|
|
|
Table 4. Estimated Prevalence of Hemochromatosis (HFE) Genotypes in the US Population by Age Group*
|
|
|
COMMENT
We evaluated the prevalence of the C282Y and H63D mutations in the HFE gene in a representative sample of the US population. These estimates are derived from a nationally representative sample of sufficient size to provide power for a more precise estimate of mutations associated with HH. Data from NHANES III indicate that the estimated prevalence of the C282Y/C282Y genotype, which is associated with 50% to 100% of HH in the US population of European descent,5, 9-13 is 0.26% or approximately 1 in 385 individuals. This frequency level falls within published estimates of between 1 in 200 and 1 in 500 individuals and translates into approximately 718 000 individuals who are homozygous for the C282Y mutation in the United States.2 Prevalence estimates for all other genotypes among non-Hispanic whites were similar to those reported in other studies that genotyped large samples from populations of European descent (Table 5). It is reasonable to assume that the group of NHANES III participants who identified themselves as non-Hispanic white is likely to represent many individuals of European descent.
|
|
|
|
Table 5. Prevalence Rates for Hemochromatosis (HFE) Genotypes in Selected Populations*
|
|
|
Although NHANES was not designed to estimate the prevalence of rare genotypes, this population did offer a sample of sufficient size to provide power to estimate prevalence for both the C282Y and H63D mutations. However, the power to estimate prevalence of homozygosity for the C282Y mutation with precision was sufficient only for the total population of 5171 participants. We compared demographic variables of race/ethnicity, sex, and age between the original sample of 8502 and our final sample of 5171 and found no significant differences, thus indicating that the sample of 5171 was not biased.
The largest and most recent estimates of genotype and allele frequencies by ethnic group32 were reported from a study of 10 198 adult members of a California health maintenance organization. Although this was not a population-based sample, estimates of genotype prevalences were similar to those reported in our analysis for non-Hispanic whites (Table 5) and the same was true for the C282Y and H63D mutation frequencies. Small differences between our estimates and those from the California study for mutation frequencies among Hispanics (C282Y: 2.7%; H63D: 12.4%)32 and blacks (C282Y: 1.1%; H63D: 5.1%)32 may have been due to the small numbers of mutations found in those groups. However, the California study did not report CIs, so the significance of those differences could not be determined.
Prevalence estimates for the C282Y/WT genotype were between 9% and 13% in other studies.17-18,30-33 We found a slightly lower prevalence of 8.33% in the general population and 9.54% in the population who is presumably of European descent. Others have estimated the prevalence of the C282Y/WT genotype to be approximately 2% in black populations32-33; our estimate was 2.3% in non-Hispanic blacks. Because the C282Y mutation has not been demonstrated in African populations,34-36 haplotype analysis is likely to show that the C282Y mutation found in blacks is the result of admixture with the white population, as is the case for C282Y mutations found in Chinese, Pacific Islander, and Australian aboriginal populations.37
The frequency of the C282Y/WT genotype in a group of Spanish blood donors was estimated to be 4.1%,13 similar to the 3.7% for Hispanics in California,32 but slightly higher than the 2.7% (95% CI, 1.89%-3.99%) found in our analysis of Mexican Americans. In a previous study, researchers found no C282Y mutations in a study of 54 chromosomes from Mexican individuals, but found a frequency of 3.2% in a study of 78 chromosomes from Spanish individuals.34 That was not a population-based study, thus the representativeness of the data from the 54 chromosomes regarding genetic characteristics of the general population is unknown. It is possible that, due to population admixture, the prevalence of C282Y is lower among individuals of Mexican origin than among individuals of Spanish origin. Seemingly contrary to this finding, a study based on California health maintenance organization data indicated that phenotypic expression of hemochromatosis was as frequent among Hispanics as among non-Hispanic whites.38 Additionally, among Mexican Americans, the prevalence of elevated transferrin saturation levels, a phenotypic indicator of hemochromatosis, was similar to or slightly less than that found among non-Hispanic whites.39 Hence, it is possible that another yet undiscovered mutation exists that may explain phenotypic expression of hemochromatosis in Mexican American populations. However, the association of the C282Y mutation with hemochromatosis among Mexican Americans has not been reported.
The frequency of the H63D mutation among non-Hispanic whites and Mexican Americans is similar to previously reported frequencies of between 6% and 30% in European populations and a mean (SE) of 6.6% (4.7%) found in Mexican populations.32, 34 The frequency of this mutation among non-Hispanic blacks, present at a low frequency in sub-Saharan African populations, is probably the result of population admixture.32, 35-36
Because mutations accounting for a large proportion of HH have been identified, and because expression of the disease is preventable, the question of screening healthy populations for HH using genetic testing has arisen. Experts recently reviewed the implications of screening for these common mutations and concluded that population-based screening for HH is not appropriate because the prevalence and penetrance of HFE mutations and the optimal care of asymptomatic individuals who have the mutations are unknown.9 Information presented here represents the first national, population-based prevalence estimate, thereby adding an important piece of the puzzle needed for making policy decisions about screening.
These findings have implications for use of genetic tests for HH screening. Information on prevalence of the mutations among ethnic groups is important for targeted screening when appropriate. However, if the prevalence for the homozygous genotype that has been associated with expression of disease is higher than the rate of the disease, that is, if penetrance of the genetic mutations is low, then the positive predictive value of the relevant genetic test may be low.
Results of our study suggest that the prevalence of homozygosity for C282Y among non-Hispanic whites and for the total US population may not be equivalent to (because of penetrance, for example) but may parallel the prevalence of hemochromatosis as defined by elevated serum iron levels.16, 40 We need additional information about other genetic and environmental factors affecting expression of hemochromatosis-associated mutations. We also need to identify new hemochromatosis-associated mutations in populations not of European descent, such as Mexican Americans and non-Hispanic blacks, to fully understand this relatively common and treatable genetic disorder.
Finally, an important step in understanding the public health significance of HFE mutations will be to relate these mutations to clinically relevant information, such as transferrin saturation levels.41 An analysis of the relationship between measures of transferrin saturation level and HFE mutations in the NHANES III population is in progress.
AUTHOR INFORMATION
Author Contributions: Study concept and design: Steinberg, Cogswell, Bowman, Grummer-Strawn, Sampson, Khoury, Gallagher.
Acquisition of data: Steinberg, McQuillan, Bowman, Gallagher.
Analysis and interpretation of data: Steinberg, Cogswell, Chang, Caudill, McQuillan, Bowman, Grummer-Strawn, Khoury, Gallagher.
Drafting of the manuscript: Steinberg, Cogswell, Caudill.
Critical revision of the manuscript for important intellectual content: Steinberg, Cogswell, Chang, Caudill, McQuillan, Bowman, Grummer-Strawn, Sampson, Khoury, Gallagher.
Statistical expertise: Cogswell, Caudill, McQuillan, Grummer-Strawn, Khoury.
Obtained funding: Cogswell, Bowman.
Administrative, technical, or material support: Steinberg, Cogswell, Chang, McQuillan, Bowman, Khoury, Gallagher.
Study supervision: Grummer-Strawn, Sampson, Gallagher.
Acknowledgment: We thank John Pfeiffer, PhD, of Applied Biosystems for his contribution in designing the primers and probes used in this study, and Giuseppina Imperatore, MD, PhD, of the Division of Diabetes Translation, National Center for Chronic Disease Prevention and Health Promotion, Centers for Disease Control and Prevention for her valuable input in reviewing the manuscript.
Corresponding Author and Reprints: Karen K. Steinberg, PhD, Molecular Biology Branch, National Center for Environmental Health, Mailstop F-24, Chamblee, GA 30341 (e-mail: kks1{at}cdc.gov).
Author Affiliations: Division of Laboratory Sciences (Drs Steinberg, Chang, Caudill, Sampson, and Gallagher), Office of Genetics and Disease Prevention (Dr Khoury), National Center for Environmental Health, and Divisions of Nutrition and Physical Activity (Drs Cogswell and Grummer-Strawn) and Diabetes Translation (Dr Bowman), National Center for Chronic Disease Prevention and Health Promotion, Centers for Disease Control and Prevention, Chamblee, Ga; and Division of Health Examination Statistics, National Center for Health Statistics, Centers for Disease Control and Prevention, Rockville, Md (Dr McQuillan).
REFERENCES
 |  |
1. Bacon BR, Powell LW, Adams PC, et al. Molecular medicine and hemochromatosis: at the crossroads. Gastroenterology. 1999;116:193-207.
FULL TEXT
| PUBMED
2. Cogswell ME, McDonnell SM, Khoury MJ, et al. Iron overload, public health, and genetics. Ann Intern Med. 1998;129:971-979.
FREE FULL TEXT
3. Powell LW, George DK, McDonnell SM, Kowdley KV. Diagnosis of hemochromatosis. Ann Intern Med. 1998;129:925-931.
FREE FULL TEXT
4. Barton JC, McDonnell SM, Adams PC, et al and the Hemochromatosis Management Working Group. Management of hemochromatosis. Ann Intern Med. 1998;129:932-939.
FREE FULL TEXT
5. Feder JN, Gnirke A, Thomas W, et al. A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis. Nat Genet. 1996;13:399-408.
FULL TEXT
|
ISI
| PUBMED
6. Bennett MJ, Lebron JA, Bjorkman PJ. Crystal structure of the hereditary haemochromatosis protein HFE complexed with transferrin receptor. Nature. 2000;403:46-53.
FULL TEXT
| PUBMED
7. Roy CN, Penny DM, Feder JN, Enns CA. The hereditary hemochromatosis protein, HFE, specifically regulates transferrin-mediated iron uptake in HeLa cells. J Biol Chem. 1999;274:9022-9028.
FREE FULL TEXT
8. Feder JN, Penny DM, Irrinki A, et al. The hemochromatosis gene product complexes with the transferrin receptor and lowers its affinity for ligand binding. Proc Natl Acad Sci U S A. 1998;95:1472-1477.
FREE FULL TEXT
9. Burke W, Thomson E, Khoury MJ, et al. Hereditary hemochromatosis: gene discovery and its implications for population-based screening. JAMA. 1998;280:172-178.
FREE FULL TEXT
10. Rivard SR, Mura C, Simard H, et al. Mutational analysis in the HFE gene inpatients with hereditary haemochromatosis in Saquenay-Lac-Saint-Jean (Quebec, Canada). Br J Haematol. 2000;108:854-858.
FULL TEXT
|
ISI
| PUBMED
11. Fabrega E, Castro B, Sanchez-Castro L, et al. Prevalence of the HFE Cys282Tyr mutation of the haemochromatosis gene (GH) in Cantabria. Med Clin (Barc). 1999;112:451-453.
12. Nielsen P, Carpinteiro S, Fischer R, et al. Prevlence of the C282Y and H63D mutations in the HFE gene in patients with hereditary haemochromatosis and in control subjects in northern Germany. Br J Haematol. 1998;103:842-845.
FULL TEXT
|
ISI
| PUBMED
13. Sanchez M, Gruguera M, Bosch J, et al. Prevalence of the Cys282Tyr and His63Asp HFE gene mutations in Spanish patients with hemochromatosis and controls. J Hepatol. 1998;29:725-728.
FULL TEXT
|
ISI
| PUBMED
14. Bradley LA, Johnson DD, Palomaki GE, et al. Hereditary haemochromatosis mutation frequencies in the general population. J Med Screen. 1998;5:34-36.
FREE FULL TEXT
15. Bacon BR, Olynyk JK, Brunt EM, et al. HFE genotype in patients with hemochromatosis and in patients with liver disease. Ann Intern Med. 1999;130:953-962.
FREE FULL TEXT
16. McDonnell SM, Hover A, Gloe D, et al. Population-based screening for hemochromatosis using phenotypic and DNA testing among employees of health maintenance organizations in Springfield, Missouri. Am J Med. 1999;107:30-37.
FULL TEXT
|
ISI
| PUBMED
17. Mortimore M, Merryweather-Clarke AT, Robson KJ, Powell LW. The haemochromatosis gene: a global perspective and implications for the Asia-Pacific region. J Gastroenterol Hepatol. 1999;14:838-843.
FULL TEXT
|
ISI
| PUBMED
18. Distante S, Berg JP, Lande K, et al. High prevalence of the hemochromatosis-associated Cys282Tyr HFE gene mutation in a healthy Norwegian population in the city of Oslo and its phenotypic expression. Scand J Gastroenterol. 1999;34:529-534.
FULL TEXT
|
ISI
| PUBMED
19. Beutler E, Gelbart T, West C, et al. Mutation analysis in hereditary hemochromatosis. Blood Cells Mol Dis. 1996;22:187-194.
FULL TEXT
|
ISI
| PUBMED
20. Steinberg KK, Sanderlin KC, Ou CY, et al. DNA banking in epidemiologic studies. Epidemiol Rev. 1997;19:156-162.
FREE FULL TEXT
21. National Center for Health Statistics. Plan and operation of the Third National Health and Nutrition Examination Survey, 1988-94. Vital Health Stat. 1994;32:1-407.
22. National Center for Health Statistics, Centers for Disease Control and Prevention. Plan and operation of the Third National Health and Nutrition Examination Survey (NHANES III, 1988-1994): reference manuals and reports. In: Weighting and Estimation Methodology Report. Hyattsville, Md: US Dept of Health and Human Services, Public Health Service, Centers for Disease Control and Prevention; 1996.
23. Clayton EW, Steinberg KK, Khoury MJ, et al. Informed consent for genetic research on stored tissue samples. JAMA. 1995;274:1786-1792.
FREE FULL TEXT
24. Livak KJ, Flood SJ, Marmaro J, et al. Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization. PCR Methods Applications. 1995;4:357-362.
ISI
| PUBMED
25. TaqMan Probe Design, Synthesis, and Purification. Foster City, Calif: Perkin-Elmer (Applied Biosystems Division); 1995.
26. Livak K, Marmaro J, Todd J. Towards fully automated genome-wide polymorphism screening. Nat Genet. 1995;9:341-342.
FULL TEXT
|
ISI
| PUBMED
27. Lynas C. A cheaper and more rapid polymerase chain reaction-restriction fragment length polymorphism method for the detection of the HLA-H gene mutations occurring in hereditary hemochromatosis. Blood. 1997;90:4235-4236.
FREE FULL TEXT
28. Weisberg S. Applied Linear Regression. 2nd ed. New York, NY: John Wiley & Sons; 1985.
29. National Center for Health Statistics. Analytic and Reporting Guidelines: The Third National Health and Nutritional Examination Survey, NHANES III (1988-94). Hyattsville, Md: National Center for Health Statistics; 1996.
30. Olynyk JK, Cullen DJ, Aquilia S, et al. A population-based study of the clinical expression of the hemochromatosis gene. N Engl J Med. 1999;341:718-724.
FREE FULL TEXT
31. Burt MJ, George PM, Upton JD, et al. The significance of haemochromatosis gene mutations in the general population. Gut. 1998;43:830-836.
FREE FULL TEXT
32. Beutler E, Felitti V, Gelbart T, Ho N. The effect of HFE genotypes on measurements of iron overload in patients attending a health appraisal clinic. Ann Intern Med. 2000;133:329-337.
FREE FULL TEXT
33. Marshall DS, Linfert DR, Tsongalis GJ. Prevalence of the C282Y and H63D polymorphisms in a multi-ethnic control population. Int J Mol Med. 1999;4:389-393.
ISI
| PUBMED
34. Merryweather-Clarke AT, Pointon JJ, Shearman JD, Robson KJ. Global prevalence of putative haemochromatosis mutations. J Med Genet. 1997;34:275-278.
FREE FULL TEXT
35. Jeffrey S, Crosby A, Plange-Rhule J, et al. Evidence from a Ghanaian population of known African descent to support the proposition that hemochromatosis is a Caucasian disorder. Genet Test. 1999;3:375-377.
ISI
| PUBMED
36. Gangaidzo IT, Moyo VM, Saugweme T, et al. Iron overload in urban Africans in the 1990s. Gut. 1999;45:278-283.
FREE FULL TEXT
37. Cullen LM, Gao X, Easteal S, Jazwinska EC. The hemochromatosis 845 G A and 187 C G mutations: prevalence in non-Caucasian populations. Am J Hum Genet. 1998;62:1403-1407.
FULL TEXT
|
ISI
| PUBMED
38. Centers for Disease Control and Prevention. Iron overload disorders among Hispanics in San Diego, California, 1995. MMWR Morb Mortal Wkly Rep. 1996;45:991-993.
PUBMED
39. Looker AC, Johnson CL. Prevalence of elevated serum transferrin saturation in adults in the United States. Ann Intern Med. 1998;129:940-945.
FREE FULL TEXT
40. Edwards CA, Griffen LM, Goldgar D, et al. Prevalence of hemochromatosis among 11,065 presumably healthy blood donors. N Engl J Med. 1988;318:1355-1362.
ABSTRACT
41. Human Genome Epidemiology Network. Available at: http://www.cdc.gov/genetics/hugenet/. Accessed March 14, 2001.
CiteULike Connotea Del.icio.us Digg Reddit Technorati
What's this?
RELATED ARTICLE
May 2, 2001
JAMA. 2001;285(17):2263-2264.
EXTRACT
| FULL TEXT
THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES
 |
Potentiation of Doxorubicin Cardiotoxicity by Iron Loading in a Rodent Model
Panjrath et al.
J Am Coll Cardiol 2007;49:2457-2464.
ABSTRACT
| FULL TEXT
The Association Between H63D Mutations in HFE and Amyotrophic Lateral Sclerosis in a Dutch Population
Sutedja et al.
Arch Neurol 2007;64:63-67.
ABSTRACT
| FULL TEXT
HFE Genetic Variability, Body Iron Stores, and the Risk of Type 2 Diabetes in U.S. Women
Qi et al.
Diabetes 2005;54:3567-3572.
ABSTRACT
| FULL TEXT
Iron supplement use and iron status among US adults: results from the third National Health and Nutrition Examination Survey
Blanck et al.
Am. J. Clin. Nutr. 2005;82:1024-1031.
ABSTRACT
| FULL TEXT
Hemochromatosis Gene Mutations, Body Iron Stores, Dietary Iron, and Risk of Colorectal Adenoma in Women
Chan et al.
JNCI J Natl Cancer Inst 2005;97:917-926.
ABSTRACT
| FULL TEXT
Hereditary hemochromatosis is reflected in the iron isotope composition of blood
Krayenbuehl et al.
Blood 2005;105:3812-3816.
ABSTRACT
| FULL TEXT
Hemochromatosis and Iron-Overload Screening in a Racially Diverse Population
Adams et al.
NEJM 2005;352:1769-1778.
ABSTRACT
| FULL TEXT
Hemochromatosis Gene Mutations and Distal Adenomatous Colorectal Polyps
McGlynn et al.
Cancer Epidemiol. Biomarkers Prev. 2005;14:158-163.
ABSTRACT
| FULL TEXT
Detecting the C282Y and H63D Mutations of the HFE Gene by Holliday Junction-Based Allele-Specific Genotyping Methods
Yang et al.
Clin. Chem. 2005;51:210-213.
FULL TEXT
Iron absorption by heterozygous carriers of the HFE C282Y mutation associated with hemochromatosis
Hunt and Zeng
Am. J. Clin. Nutr. 2004;80:924-931.
ABSTRACT
| FULL TEXT
The emergence of epidemiology in the genomics age
Khoury et al.
Int J Epidemiol 2004;33:936-944.
FULL TEXT
HFE mutations are not strongly associated with sporadic ALS
Yen et al.
Neurology 2004;62:1611-1612.
ABSTRACT
| FULL TEXT
Increased Prevalence of the HFE C282Y Hemochromatosis Allele in Women with Breast Cancer
Kallianpur et al.
Cancer Epidemiol. Biomarkers Prev. 2004;13:205-212.
ABSTRACT
| FULL TEXT
Contribution of the H63D mutation in HFE to murine hereditary hemochromatosis
Tomatsu et al.
Proc. Natl. Acad. Sci. USA 2003;100:15788-15793.
ABSTRACT
| FULL TEXT
Hereditary Hemochromatosis and Its Elusive Natural History
McDonnell and Parrish
Arch Intern Med 2003;163:2421-2423.
FULL TEXT
HFE Gene Mutations in Chile
Wohllk et al.
ANN INTERN MED 2003;139:708-709.
FULL TEXT
Bioavailability of iron, zinc, and other trace minerals from vegetarian diets
Hunt
Am. J. Clin. Nutr. 2003;78:633S-639.
ABSTRACT
| FULL TEXT
The HFE Cys282Tyr mutation as a necessary but not sufficient cause of clinical hereditary hemochromatosis
Beutler
Blood 2003;101:3347-3350.
FULL TEXT
Rebuttal to Ajioka and Kushner
Beutler
Blood 2003;101:3354-3357.
FULL TEXT
Association Between Hemochromatosis (HFE) Gene Mutation Carrier Status and the Risk of Colon Cancer
Shaheen et al.
JNCI J Natl Cancer Inst 2003;95:154-159.
ABSTRACT
| FULL TEXT
Population Screening in the Age of Genomic Medicine
Khoury et al.
NEJM 2003;348:50-58.
FULL TEXT
Iron stores and cardiovascular disease risk factors in women of reproductive age in the United States
Ramakrishnan et al.
Am. J. Clin. Nutr. 2002;76:1256-1260.
ABSTRACT
| FULL TEXT
Do body iron stores increase the risk of developing coronary heart disease?
Sempos
Am. J. Clin. Nutr. 2002;76:501-503.
FULL TEXT
Prevalence of HFE gene C282Y and H63D mutations in a French-Canadian population of neonates and in referred patients
Girouard et al.
Hum Mol Genet 2002;11:185-189.
ABSTRACT
| FULL TEXT
Genetic Testing and Medical Decision Making
Reyna et al.
Arch Intern Med 2001;161:2406-2408.
FULL TEXT
Association of Mutations in the Hemochromatosis Gene With Shorter Life Expectancy
Bathum et al.
Arch Intern Med 2001;161:2441-2444.
ABSTRACT
| FULL TEXT
|