You are seeing this message because your Web browser does not support basic Web standards. Find out more about why this message is appearing and what you can do to make your experience on this site better.


ABOUT JAMA
Advanced Search

Welcome   | My Account | E-mail Alerts | Access Rights | Sign In


  Vol. 285 No. 22, June 13, 2001 TABLE OF CONTENTS
  JAMA
  •  Online Features
  Original Contribution
 This Article
 •Abstract
 •PDF
 •Correction
 •Send to a friend
 • Save in My Folder
 •Save to citation manager
 •Permissions
 Citing Articles
 •Citation map
 •Citing articles on HighWire
 •Citing articles on ISI (67)
 •Contact me when this article is cited
 Related Content
 •Related articles
 •Similar articles in JAMA
 Topic Collections
 •Aging/ Geriatrics
 •Oncology
 •Breast Cancer
 •Osteoporosis
 •Women's Health, Other
 •Alert me on articles by topic

Association Between the T29->C Polymorphism in the Transforming Growth Factor {beta}1 Gene and Breast Cancer Among Elderly White Women

The Study of Osteoporotic Fractures

Elad Ziv, MD; Jane Cauley, DrPH; Phillip A. Morin, PhD; Robert Saiz, BS; Warren S. Browner, MD,MPH

JAMA. 2001;285:2859-2863.

ABSTRACT

Context  Transgenic animal experiments suggest that increased expression of transforming growth factor {beta}1 (TGF-{beta}1) is protective against early tumor development, particularly in breast cancer. A T->C (thymine to cytosine) transition in the 29th nucleotide in the coding sequence results in a leucine to proline substitution at the 10th amino acid and is associated with increased serum levels of TGF-{beta}1.

Objective  To determine whether an association exists between this TGF-{beta}1 polymorphism and breast cancer risk.

Design, Setting, and Participants  The Study of Osteoporotic Fractures, a prospective cohort study of white, community-dwelling women aged 65 years or older who were recruited at 4 US centers between 1986 and 1988. Three thousand seventy-five women who provided sufficient clinical information, buffy coat samples, and adequate consent for genotyping are included in this analysis.

Main Outcome Measure  Breast cancer cases during a mean (SD) follow-up of 9.3 (1.9) years, verified by medical chart review and compared by genotype.

Results  Risk of breast cancer was similar in the 1124 women with the T/T genotype (56 cases; 5.4 per 1000 person-years) and the 1493 women with the T/C genotype (80 cases; 5.8 per 1000 person-years) but was significantly lower (P = .01) in the 458 women with the C/C genotype (10 cases; 2.3 per 1000 person-years). In analyses that adjusted for age, age at menarche, age at menopause, estrogen use, parity, body mass index, and bone mineral density, women with the C/C genotype had a significantly lower risk of developing breast cancer compared with women with the T/T or T/C genotype (hazard ratio [HR], 0.36; 95% confidence interval [CI], 0.17-0.75). There was no significant difference between the risk for women with the T/C genotype compared with women with the T/T genotype (adjusted HR, 1.04; 95% CI, 0.73-1.48).

Conclusions  Our findings suggest that TGF-{beta}1 genotype is associated with risk of breast cancer in white women aged 65 years or older. Because the T allele is the common variant and confers an increased risk, it may be associated with a large proportion of breast cancer cases.



INTRODUCTION
 Jump to Section
 •Top
 •Introduction
 •Methods
 •Results
 •Comment
 •Author information
 •References

Family history is a known risk factor for the development of breast cancer.1 Two genes (BRCA1 and BRCA2) associated with markedly increased risk of breast cancer have been identified, but mutations in these genes are relatively uncommon and account for a small fraction of breast cancer.2-3 Therefore, other genes are likely to modify the risk of breast cancer.4

Several lines of evidence suggest that abnormalities in the transforming growth factor {beta} (TGF-{beta}) pathway may be involved in oncogenesis, particularly in the development of breast cancer. In most epithelial and endothelial cells, activation of the pathway causes arrest of the cell cycle, and TGF-{beta} is a potent inhibitor of mammary cell lines.5 A recent case-control study reported that a polymorphism in the type I receptor for TGF-{beta} that leads to decreased biological activity may be associated with increased risk of cancer.6 Changes in the expression of one of the TGF-{beta} ligands, TGF-{beta}1, have also been implicated in oncogenesis in transgenic mice. Deletion of 1 copy of the TGF-{beta}1 gene leads to increased cell turnover and susceptibility to chemical carcinogens,7 while increased expression of TGF-{beta}1 under the control of a murine mammary tumor virus promoter reduces the risk of induced mammary carcinoma.8

Several polymorphisms have been reported within the human TGF-{beta}1 gene.9-11 One polymorphism, a T->C transition in the 29th nucleotide of the coding sequence, results in a leucine to proline substitution at the 10th amino acid and leads to higher serum levels of TGF-{beta}1.11 Tang et a17 have hypothesized that polymorphisms that either inactivate TGF-{beta}1 or are associated with variations in level of expression may alter susceptibility to cancer in humans.

The Study of Osteoporotic Fractures is a prospective cohort study of 9704 white community-dwelling women who were 65 years of age or older at enrollment. As part of the study, we tested several polymorphisms for their effect on osteoporosis and other outcomes, including breast cancer. Here we test the hypothesis of Tang et al7 by examining the association between the T29->C polymorphism in the TGF-{beta}1 gene and the risk of breast cancer. Because of the possible association between TGF-{beta}1 and bone density12 and between bone density and breast cancer,13-14 we also determined whether bone mass affected the association between this polymorphism and breast cancer.


METHODS
 Jump to Section
 •Top
 •Introduction
 •Methods
 •Results
 •Comment
 •Author information
 •References

Study Participants

Women in the Study of Osteoporotic Fractures were recruited between 1986 and 1988 at 4 centers in the United States. Of the initial cohort of 9704 women, 9339 women returned to the second clinic visit, at which time we obtained buffy coat samples from 6795 women; these were frozen at -190°C for future analyses. Of the women for whom buffy coat samples were collected, 3382 had sufficient buffy coat samples available and provided adequate consent to perform genotyping. We excluded 158 women who reported a history of breast cancer before study onset, as these self-reported cases were not confirmed by review of medical records. We also excluded 106 women who did not provide follow-up information on occurrence of breast cancer. In 37 women, the genotyping assay for the TGF-{beta}1 polymorphism failed. For 6 women who reported cancer—3 with the T/C genotype and 3 with the T/T genotype—medical records could not be obtained for verification of diagnosis. These women were also excluded, leaving 3075 women who were included in the analyses. Women who were not genotyped were on average 0.9 years older than the women who were genotyped (P<.001). The proportion who developed breast cancer among the genotyped women (5.0%) was not significantly different from the proportion who developed breast cancer in the women who were not genotyped (4.3%) (P = .14).

Variables

Age at menarche, age at menopause, reproductive history, family history of breast cancer, and prior estrogen use were determined by questionnaire. We defined a positive family history of breast cancer as a report of breast cancer in a participant's mother or sister. Reports of current medication use were checked against the medications brought to clinic visits. Weight (in lightweight clothing with shoes removed) was measured using a balance beam scale. Self-reported height at 25 years of age was used to calculate the modified body mass index (BMI). Body mass index was adjusted for height at age 25 years because women with low bone mass experience height loss due to vertebral fractures. Bone mineral density was measured by proximal femur dual-energy x-ray absorptiometry (QDR 1000, Hologic Inc, Waltham, Mass). Blood was drawn and buffy coat was sequestered after centrifugation, stored at -20°C, and shipped within 2 weeks to a central repository where it was stored at -190°C until analyzed.

Genotyping Methods

To determine each woman's genotype we used the 5' exonuclease assay, a method of high-throughput screening for single nucleotide polymorphisms.15 The assay is based on the polymerase chain reaction (PCR) and uses the 5' exonuclease activity of Taq DNA polymerase. Allele-specific oligonucleotide probes are added to the PCR reaction and are cleaved by the 5' exonuclease activity of Taq polymerase only if genomic DNA includes the corresponding variant of the polymorphism. The probes are labeled at the 5' end with the reporter dye (FAM or TET) and at the 3' end with the quencher dye (TAMRA). When the probes are degraded by Taq polymerase, the genotypes can be determined by measuring the increase in 1 or both of the fluorescent reporter dyes. The PCR primers used were 5'-CCCACCACACCAGCCCTGTTC in the forward direction and 5'-TTCCGCTTCACCAGCTCCATGT in the reverse direction. The probe used for the T allele was TAGCAGCAGCAGCAGCAGCCGC and for the C allele was TAGCAGCAGCGGCAGCAGCCG. The PCR reaction mixtures included 20 ng of genomic DNA in a 10-µL reaction volume and the following concentration of other reagents: probes (200 nM each), primers (0.9 µM each), 1x TaqMan PCR Master Mix (PE Applied Biosystems, Foster City, Calif). Polymerase chain reaction cycling conditions consisted of a preincubation period of 2 minutes at 50°C, an initial denaturation period of 10 minutes at 95°C, an annealing period of 60 seconds at 64°C, followed by a denaturation period of 15 minutes at 95°C for 45 cycles. We used the ABI Prism 7700 Sequence Detector (PE Applied Biosystems) for data acquisition.

Ascertainment of Breast Cancer

Information on breast cancer incidence was collected at year 1 of the study and subsequently at yearly intervals. Breast cancer cases were confirmed by review of medical records by adjudication by a study physician who was blinded to genotype. A random sample of 10% of the cases was reviewed by an expert pathologist. We also collected information on stage of diagnosis and estrogen-receptor status by medical record review.

Statistical Analysis

Allele frequencies were estimated by the gene counting method, and departures from Hardy-Weinberg equilibrium were tested using a {chi}2 test. We compared baseline characteristics using analysis of variance for continuous measures that were approximately normally distributed (ages at menarche, menopause, birth of first child, breast cancer diagnosis), the Kruskal-Wallis test for measures that were not normally distributed (age, number of deliveries), and {chi}2 tests for categorical comparisons (estrogen use, history of any birth, family history of breast cancer). The Kaplan-Meier method was used to estimate the cumulative risk of breast cancer by genotype. To determine the effect of genotype on breast cancer development, we used Cox proportional hazards models to estimate hazard ratios (HRs) and 95% confidence intervals (CIs) for the associations between TGF-{beta}1 genotype and breast cancer. Other variables were entered into the model based on prior reported associations with breast cancer.1, 14 The basic multivariable model included genotype, age, age at menarche, age at menopause, parity, and BMI. Parity was entered into the model by grouping nulliparous women with women whose first birth was after the age of 30 years. In a separate analysis we entered family history of breast cancer into the multivariable model and then entered genotype to determine whether the relationship between family history and breast cancer is modified by genotype. To determine whether bone mineral density confounds the effect of genotype on breast cancer risk, we entered bone mineral density into the basic multivariable model with genotype. We used the Fisher exact test to compare the proportion of estrogen-receptor positive and negative cases among women of different genotypes and to compare stage at diagnosis among women of different genotypes.


RESULTS
 Jump to Section
 •Top
 •Introduction
 •Methods
 •Results
 •Comment
 •Author information
 •References

Overall, there were no differences in participants' age, reproductive history, use of estrogen, BMI, or other potential risk factors for cancer by genotype (Table 1). The frequency of the C/C genotype was 14.9%, the T/C genotype was 48.6%, and the T/T genotype was 36.7%; there was no evidence of departure from Hardy-Weinberg equilibrium (P = .23).


View this table:
[in this window]
[in a new window]
Table 1. Characteristics of Women at Baseline by Genotype of TGF-{beta}1 at Position 29


During a mean (SD) of 9.3 (1.9) years of follow-up, 146 women developed breast cancer, including 10 women with the C/C allele (2.3 per 1000 person-years), 80 with the T/C genotype (5.8 per 1000 person-years), and 56 with the T/T genotype (5.4 per 1000 person-years). The risk of breast cancer was markedly lower among women with the C/C genotype (Figure 1) when compared with women who had the T/T genotype (HR, 0.43; 95% CI, 0.22-0.84; P = .01) (Table 2) or when compared with women who had at least 1 T allele (HR, 0.42; 95% CI, 0.22-0.79; P = .007). Adjusting for age, age at menarche, age at menopause, parity, estrogen use, and BMI did not substantially alter the magnitude of the relations between the C/C genotype and the risk of breast cancer when compared with the T/T genotype (HR, 0.36; 95% CI, 0.17-0.75; P = .007) or when compared with women who had at least 1 T allele (HR, 0.31; 95% CI, 0.15-0.67; P = .003). There was no detectable difference in breast cancer risk between women with the T/C genotype and those homozygous for the T allele in unadjusted (HR, 1.06; 95% CI, 0.75-1.49; P = .74) or adjusted analyses (HR, 1.04; 95% CI, 0.73-1.48; P = .85).



View larger version (20K):
[in this window]
[in a new window]
Figure. Cumulative Probability of Developing Breast Cancer



View this table:
[in this window]
[in a new window]
Table 2. Risk of Breast Cancer by TGF-{beta}1 Genotype at Position 29*


Family history of a first-degree relative with breast cancer was associated with a nonsignificant increase in the risk of breast cancer (adjusted HR, 1.3; 95% CI, 0.8-2.0; P = .31). Addition of TGF-{beta}1 genotype to the multivariable model did not significantly change this association (HR, 1.2; 95% CI, 0.7-2.0; P = .49).

There was no relation between TGF-{beta}1 genotype and hip bone mineral density (Table 1). Addition of hip bone mineral density to the multivariable model did not alter the relation between the C/C genotype and breast cancer risk (HR, 0.36; 95% CI, 0.17-0.75; P = .007) or the T/C genotype and breast cancer risk (HR, 1.04; 95% CI, 0.73-1.48; P = .84).

Among women who developed breast cancer, those with the C/C genotype were significantly older at diagnosis than those with the other genotypes (Table 3). There were no significant differences in the estrogen-receptor status or stage at diagnosis of breast cancers among women of different genotypes (Table 3).


View this table:
[in this window]
[in a new window]
Table 3. Clinical Characteristics of Breast Cancer Cases by TGF-{beta}1 Genotype*



COMMENT
 Jump to Section
 •Top
 •Introduction
 •Methods
 •Results
 •Comment
 •Author information
 •References

We found that the C/C genotype at nucleotide 29 of the TGF-{beta}1 gene was associated with markedly reduced risk of breast cancer in women older than 65 years in comparison with the T/C and T/T genotypes. Our finding supports the results of studies in cell lines and transgenic mice. In vitro studies have shown that increased activity in the TGF-{beta}1 pathway is a potent inhibitor of most mammary cell lines.16-17 Transgenic mice with single gene deletion of TGF-{beta}1 are more susceptible to liver and lung tumors induced by carcinogens.7 Transgenic mice with increased expression of TGF-{beta}1 under a murine mammary tumor virus promoter develop hypoplastic mammary glands in comparison with wild-type mice and have lower susceptibility to carcinogen-induced mammary tumors.8 A study of Japanese men and women has found that the C/C genotype was associated with higher serum levels of TGF-{beta}1 than either the T/T or T/C genotype.11 Thus, increased serum levels in subjects with the C/C genotype may contribute to long-term suppression of mammary epithelial growth and lead to lower risk of breast cancer.

Although the T/C genotype appears to be associated with intermediate serum levels of TGF-{beta}1,11 we did not find a difference in breast cancer risk between women with the T/C genotype and the T/T genotype. One explanation may be that heterozygosity for this polymorphism confers an intermediate-risk status that we could not discern. However, the T/C genotype was the most common genotype in our sample, and the CI for the HR for the T/C allele and breast cancer (as compared with the T/T allele) was relatively narrow (0.75-1.49). Another possibility is that the increased serum levels of TGF-{beta}1 that are associated with the C allele require a threshold effect to reduce risk.

We and others13-14 have shown that women with lower bone mineral density have a reduced risk of breast cancer. In Japanese women, the C/C genotype (which was associated with lower risk of breast cancer in this study) is associated with greater bone mass.12, 18 However, we did not find any association between TGF-{beta}1 genotype and bone mineral density in this study, and including bone mineral density in the multivariable models did not change the association between TGF-{beta}1 genotype and breast cancer risk.

Our study has several important limitations. The women in our study were all older than 65 years at enrollment, and most of the cancers occurred in women older than 70 years. Therefore, our study does not address the relation between TGF-{beta}1 polymorphisms and breast cancer in younger women. Indeed, it is theoretically possible that the effects of the polymorphism differ by age or menopausal status. For example, the C/C genotype—which was associated with a decreased risk of breast cancer in older women—might be associated with an increased risk in younger women. If polymorphisms in the TGF-{beta}1 gene were the major determinant of the disease, older women with this genotype might subsequently appear to be protected against breast cancer. We believe this is unlikely for the following reasons: allele frequency was in Hardy-Weinberg equilibrium, the C/C genotype was also associated with a delayed age at diagnosis in older women, and there are almost certainly other important determinants of breast cancer. Our study sample consists of mainly white women. Differences in background genetic variability may alter the importance of any particular gene and, therefore, it is possible that this relation may differ in women of other ancestries. Although we could not detect a difference in tumor stage at diagnosis or estrogen-receptor status at diagnosis by genotype, only 10 cases of breast cancer developed in women with the C/C genotype. Finally, we did not measure serum TGF-{beta}1 levels.

About 85% of the women in our study had at least 1 T allele for the TGF-{beta}1 gene, which was associated with a 2.5- to 3-fold increased risk of breast cancer in comparison with women who had the C/C genotype. If the T allele is regarded as a risk factor for breast cancer, then the population-attributable risk associated with this allele is approximately 60%. Thus, if this association is real and causal, this allele is associated with a substantial fraction of cancers among older white women in the United States.

Initial reports have demonstrated associations between polymorphisms in several other genes and breast cancer risk. For example, the A2 allele of CYP17 has been associated with advanced breast cancer,19 and a polymorphism in the N-acetyltransferase 2 gene has been associated and breast cancer in postmenopausal smokers.20 However, follow-up studies have produced inconsistent results for these21-22 and other genetic markers in breast cancer.23-24 Although the association between TGF-{beta}1 and breast cancer risk is supported by transgenic mouse models and the association between cancer and the type I TGF-{beta} receptor in humans, our initial findings should be independently verified.

Our results suggest several avenues of future research. Other polymorphisms have been described in the gene for TGF-{beta}1, including polymorphisms in the promoter that have been associated with increased serum levels.10 One other study has identified a germline mutation in the type I receptor for TGF-{beta} that is associated with an increased risk of cancer.6 When gene-gene interaction between polymorphisms in TGF-{beta}1 and polymorphisms in the receptors are taken into account, prediction of breast cancer risk may become more accurate.


AUTHOR INFORMATION
 Jump to Section
 •Top
 •Introduction
 •Methods
 •Results
 •Comment
 •Author information
 •References

Author Contributions: Study concept and design: Ziv, Browner.

Acquisition of data: Cauley, Morin, Saiz, Browner.

Analysis and interpretation of data: Ziv, Browner.

Drafting of the manuscript: Ziv, Browner.

Critical revision of the manuscript for important intellectual content: Ziv, Cauley, Morin, Saiz, Browner.

Statistical expertise: Ziv, Browner.

Obtained funding: Cauley, Browner.

Administrative, technical, or material support: Cauley, Morin, Saiz, Browner.

Study supervision: Browner.

Funding/Support: This work was supported by grants AG05407, AR35582, AG05349, AR35584, and AR35583 from the Public Health Service.

Acknowledgment: We are grateful to Steven Cummings, MD, and Michael Shlipak, MD, for insightful comments on earlier versions of this article.

Financial Disclosure: Dr Cauley receives research support from Merck & Co, Wyeth-Ayerst Research, Eli Lilly & Co, and Roche Pharmaceuticals and has received honoraria from Eli Lilly & Co, Merk & Co, and Procter & Gamble.

Corresponding Author and Reprints: Elad Ziv, MD, Division of General Internal Medicine, Veterans Affairs Medical Center, Box 111-A1, 4150 Clement St, San Francisco, CA 94122 (e-mail: eziv{at}itsa.ucsf.edu).

Author Affiliations: Division of General Internal Medicine, San Francisco Veterans Affairs Medical Center (Drs Browner and Ziv), Departments of Medicine (Drs Browner and Ziv) and Epidemiology and Biostatistics (Dr Browner), University of California, San Francisco; Department of Epidemiology, Graduate School of Public Health, University of Pittsburgh, Pittsburgh, Pa (Dr Cauley); and Axys Pharmaceutical Inc, La Jolla, Calif (Dr Morin and Mr Saiz). Dr Browner is now with the California Pacific Medical Center Research Institute, San Francisco; Dr Morin is now with the Max Plank Institute for Evolutionary Anthropology, Leipzig, Germany; and Mr Saiz is now with Althea Technologies, San Diego, Calif.


REFERENCES
 Jump to Section
 •Top
 •Introduction
 •Methods
 •Results
 •Comment
 •Author information
 •References

1. Armstrong K, Eisen A, Weber B. Assessing the risk of breast cancer. N Engl J Med. 2000;342:564-571. FREE FULL TEXT
2. Newman B, Mu H, Butler LM, Millikan RC, Moorman PG, King MC. Frequency of breast cancer attributable to BRCA1 in a population-based series of American women. JAMA. 1998;279:915-921. FREE FULL TEXT
3. Ford D, Easton DF, Peto J. Estimates of the gene frequency of BRCA1 and its contribution to breast and ovarian cancer incidence. Am J Hum Genet. 1995;57:1457-1462. ISI | PUBMED
4. Rebbeck TR. Inherited genetic predisposition in breast cancer: a population-based perspective. Cancer. 1999;86(11 suppl):2493-2501.
5. Blobe GC, Schiemann WP, Lodish HF. Role of transforming growth factor beta in human disease. N Engl J Med. 2000;342:1350-1358. FREE FULL TEXT
6. Pasche B, Kolachana P, Nafa K, et al. TbetaR-I(6A) is a candidate tumor susceptibility allele. Cancer Res. 1999;59:5678-5682. FREE FULL TEXT
7. Tang B, Bottinger EP, Jakowlew SB, et al. Transforming growth factor-beta1 is a new form of tumor suppressor with true haploid insufficiency. Nat Med. 1998;4:802-807. FULL TEXT | ISI | PUBMED
8. Pierce DF Jr, Gorska AE, Chytil A, et al. Mammary tumor suppression by transforming growth factor beta 1 transgene expression. Proc Natl Acad Sci U S A. 1995;92:4254-4258. FREE FULL TEXT
9. Cambien F, Ricard S, Troesch A, et al. Polymorphisms of the transforming growth factor-beta 1 gene in relation to myocardial infarction and blood pressure: the Etude Cas-Témoin de l'Infarctus du Myocarde (ECTIM) Study. Hypertension. 1996;28:881-887. FREE FULL TEXT
10. Grainger DJ, Heathcote K, Chiano M, et al. Genetic control of the circulating concentration of transforming growth factor type beta1. Hum Mol Genet. 1999;8:93-97. FREE FULL TEXT
11. Yokota M, Ichihara S, Lin TL, Nakashima N, Yamada Y. Association of a T29->C polymorphism of the transforming growth factor-beta1 gene with genetic susceptibility to myocardial infarction in Japanese. Circulation. 2000;101:2783-2787. FREE FULL TEXT
12. Yamada Y, Miyauchi A, Goto J, et al. Association of a polymorphism of the transforming growth factor-beta1 gene with genetic susceptibility to osteoporosis in postmenopausal Japanese women. J Bone Miner Res. 1998;13:1569-1576. FULL TEXT | ISI | PUBMED
13. Zhang Y, Kiel DP, Kreger BE, et al. Bone mass and the risk of breast cancer among postmenopausal women. N Engl J Med. 1997;336:611-617. FREE FULL TEXT
14. Cauley JA, Lucas FL, Kuller LH, Vogt MT, Browner MS, Cummings SR. Bone mineral density and risk of breast cancer in older women: the study of osteoporotic fractures: Study of Osteoporotic Fractures Research Group. JAMA. 1996;276:1404-1408. ABSTRACT
15. Morin PA, Saiz R, Monjazeb A. High-throughput single nucleotide polymorphism genotyping by fluorescent 5' exonuclease assay. Biotechniques. 1999;27:538-540, 542, 544. ISI | PUBMED
16. Arteaga CL, Dugger TC, Hurd SD. The multifunctional role of transforming growth factor (TGF)-beta s on mammary epithelial cell biology. Breast Cancer Res Treat. 1996;38:49-56. FULL TEXT | ISI | PUBMED
17. Reiss M, Barcellos-Hoff MH. Transforming growth factor-beta in breast cancer: a working hypothesis. Breast Cancer Res Treat. 1997;45:81-95. FULL TEXT | ISI | PUBMED
18. Yamada Y, Hosoi T, Makimoto F, Tanaka H, Seino Y, Ikeda K. Transforming growth factor beta-1 gene polymorphism and bone mineral density in Japanese adolescents. Am J Med. 1999;106:477-479. FULL TEXT | ISI | PUBMED
19. Feigelson HS, Coetzee GA, Kolonel LN, Ross RK, Henderson BE. A polymorphism in the CYP17 gene increases the risk of breast cancer. Cancer Res. 1997;57:1063-1065. FREE FULL TEXT
20. Ambrosone CB, Freudenheim JL, Graham JL, et al. Cigarette smoking, N-acetyltransferase 2 genetic polymorphisms, and breast cancer risk. JAMA. 1996;276:1494-1501. ABSTRACT
21. Dunning AM, Healey C, Pharoah PH, et al. No association between a polymorphism in the steroid metabolism gene CYP17 and risk of breast cancer. Br J Cancer. 1998;77:2045-2047. ISI | PUBMED
22. Millikan RC, Pittman GS, Newman B, et al. Cigarette smoking, N-acetyltransferases 1 and 2, and breast cancer risk. Cancer Epidemiol Biomarkers Prev. 1998;7:371-378. FREE FULL TEXT
23. Dunning AM, Healey CS, Pharoah PD, Teare MD, Ponder BA, Easton DF. A systematic review of genetic polymorphisms and breast cancer risk. Cancer Epidemiol Biomarkers Prev. 1999;8:843-854. FREE FULL TEXT
24. Coughlin SS, Piper M. Genetic polymorphisms and risk of breast cancer. Cancer Epidemiol Biomarkers Prev. 1999;8:1023-1032. FREE FULL TEXT

RELATED ARTICLES

Genetic Susceptibility to Breast Cancer: From the Roll of the Dice to the Hand Women Were Dealt
Katrina Armstrong
JAMA. 2001;285(22):2907-2909.
EXTRACT | FULL TEXT  

June 13, 2001
JAMA. 2001;285(22):2921-2922.
EXTRACT | FULL TEXT  


THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES

Association of Genetic Variation in the Transforming Growth Factor {beta}-1 Gene with Serum Levels and Risk of Colorectal Neoplasia
Saltzman et al.
Cancer Res. 2008;68:1236-1244.
ABSTRACT | FULL TEXT  

Transforming Growth Factor {beta} Receptor Type I and Transforming Growth Factor {beta}1 Polymorphisms Are Not Associated with Postmenopausal Breast Cancer.
Feigelson et al.
Cancer Epidemiol. Biomarkers Prev. 2006;15:1236-1237.
FULL TEXT  

Genetic variants of Tgfb1 act as context-dependent modifiers of mouse skin tumor susceptibility
Mao et al.
Proc. Natl. Acad. Sci. USA 2006;103:8125-8130.
ABSTRACT | FULL TEXT  

Association of polymorphism in the transforming growth factor {beta}1 gene with disease outcome and mortality in rheumatoid arthritis
Mattey et al.
Ann Rheum Dis 2005;64:1190-1194.
ABSTRACT | FULL TEXT  

Genetic Polymorphisms of the Transforming Growth Factor-{beta}1 Gene and Breast Cancer Risk: A Possible Dual Role at Different Cancer Stages
Shin et al.
Cancer Epidemiol. Biomarkers Prev. 2005;14:1567-1570.
ABSTRACT | FULL TEXT  

Combined Genetic Assessment of Transforming Growth Factor-{beta} Signaling Pathway Variants May Predict Breast Cancer Risk
Kaklamani et al.
Cancer Res. 2005;65:3454-3461.
ABSTRACT | FULL TEXT  

Role of Transforming Growth Factor Beta in Human Cancer
Elliott and Blobe
JCO 2005;23:2078-2093.
ABSTRACT | FULL TEXT  

Dual Role of Transforming Growth Factor {beta} in Mammary Tumorigenesis and Metastatic Progression
Muraoka-Cook et al.
Clin. Cancer Res. 2005;11:937s-943s.
ABSTRACT | FULL TEXT  

Conditional Overexpression of Active Transforming Growth Factor {beta}1 In vivo Accelerates Metastases of Transgenic Mammary Tumors
Muraoka-Cook et al.
Cancer Res. 2004;64:9002-9011.
ABSTRACT | FULL TEXT  

THE ROLE OF TGF-{beta} IN EPITHELIAL MALIGNANCY AND ITS RELEVANCE TO THE PATHOGENESIS OF ORAL CANCER (PART II)
Prime et al.
Crit. Rev. Oral Biol. Med. 2004;15:337-347.
ABSTRACT | FULL TEXT  

TGF{beta}1 polymorphism (L10P) and risk of colorectal adenomatous and hyperplastic polyps
Sparks et al.
Int J Epidemiol 2004;33:955-961.
ABSTRACT | FULL TEXT  

A Gain of Function TGFB1 Polymorphism May Be Associated With Late Stage Prostate Cancer
Ewart-Toland et al.
Cancer Epidemiol. Biomarkers Prev. 2004;13:759-764.
ABSTRACT | FULL TEXT  

An Evolutionary Perspective on Single-Nucleotide Polymorphism Screening in Molecular Cancer Epidemiology
Zhu et al.
Cancer Res. 2004;64:2251-2257.
ABSTRACT | FULL TEXT  

T29C Polymorphism in the Transforming Growth Factor {beta}1 Gene and Postmenopausal Breast Cancer Risk: The Multiethnic Cohort Study
Marchand et al.
Cancer Epidemiol. Biomarkers Prev. 2004;13:412-415.
ABSTRACT | FULL TEXT  

Genetic Polymorphisms in the TGF-{beta}1 Gene and Breast Cancer Survival: A Report from the Shanghai Breast Cancer Study
Shu et al.
Cancer Res. 2004;64:836-839.
ABSTRACT | FULL TEXT  

Increased risk of prostate cancer and benign prostatic hyperplasia associated with transforming growth factor-beta 1 gene polymorphism at codon10
Li et al.
Carcinogenesis 2004;25:237-240.
ABSTRACT | FULL TEXT  

TGFBR1*6A and Cancer Risk: A Meta-Analysis of Seven Case-Control Studies
Kaklamani et al.
JCO 2003;21:3236-3243.
ABSTRACT | FULL TEXT  

Genetic modifiers interact with maternal determinants in vascular development of Tgfb1-/- mice
Tang et al.
Hum Mol Genet 2003;12:1579-1589.
ABSTRACT | FULL TEXT  

Smad3 Regulates Senescence and Malignant Conversion in a Mouse Multistage Skin Carcinogenesis Model
Vijayachandra et al.
Cancer Res. 2003;63:3447-3452.
ABSTRACT | FULL TEXT  

A Transforming Growth Factor{beta}1 Signal Peptide Variant Increases Secretion in Vitro and Is Associated with Increased Incidence of Invasive Breast Cancer
Dunning et al.
Cancer Res. 2003;63:2610-2615.
ABSTRACT | FULL TEXT  

Genetic Testing
Burke
NEJM 2002;347:1867-1875.
FULL TEXT  

Rapamycin Potentiates Transforming Growth Factor {beta}-Induced Growth Arrest in Nontransformed, Oncogene-Transformed, and Human Cancer Cells
Law et al.
Mol. Cell. Biol. 2002;22:8184-8198.
ABSTRACT | FULL TEXT  

Latent Transforming Growth Factor-{beta} Activation in Mammary Gland : Regulation by Ovarian Hormones Affects Ductal and Alveolar Proliferation
Ewan et al.
Am. J. Pathol. 2002;160:2081-2093.
ABSTRACT | FULL TEXT  

Implications of the Human Genome for Understanding Human Biology and Medicine
Subramanian et al.
JAMA 2001;286:2296-2307.
ABSTRACT | FULL TEXT  

Genetic Susceptibility to Breast Cancer: From the Roll of the Dice to the Hand Women Were Dealt
Armstrong
JAMA 2001;285:2907-2909.
FULL TEXT  





HOME | CURRENT ISSUE | PAST ISSUES | TOPIC COLLECTIONS | CME | SUBMIT | SUBSCRIBE | HELP
CONDITIONS OF USE | PRIVACY POLICY | CONTACT US | SITE MAP
 
© 2001 American Medical Association. All Rights Reserved.