 |
 |

Association of the Cyclin D1 A870G Polymorphism With Advanced Colorectal Cancer
Loïc Le Marchand, MD, PhD;
Ann Seifried, BA;
Annette Lum-Jones, BS;
Timothy Donlon, PhD;
Lynne R. Wilkens, DrPH
JAMA. 2003;290:2843-2848.
ABSTRACT
 |  |
Context Cyclin D1 (CCND1) is a key cell cycle regulatory protein, the overexpression of which is often found in human tumors and is associated with cell proliferation and poor prognosis. A common adenine-to-guanine substitution polymorphism (A870G) in the CCND1 gene results in an altered messenger RNA transcript and a longer-life protein, which are preferentially encoded by the A allele.
Objective To test the overall and stage-specific associations of the CCND1 870A allele with colorectal cancer.
Design, Setting, and Participants A population-based case-control study conducted in the multiethnic population of Hawaii between January 1, 1994, and August 31, 1998, which included 504 patients with incident colorectal cancer and 624 population-based participants of Japanese, white, or Native Hawaiian origin. Participation rates were 58% for cases and 52% for controls.
Main Outcome Measurement Ethnicity, gene-dosage effects, and stage (regional/distant) and subsite (colon vs rectal) of cancer.
Results The odds ratio (OR) for the CCND1 870 GA and AA genotypes compared with the GG genotype was 1.2 (95% confidence interval [CI], 0.9-1.7) and 1.5 (95% CI, 1.0-2.1), respectively (P = .03 for gene-dosage effect). These risk estimates were significantly greater for patients diagnosed at a regional or distant stage (GA vs GG: OR, 1.7; 95% CI, 1.1-2.5 and AA vs GG: OR, 1.9; 95% CI, 1.2-3.1; P = .008 for gene-dosage effect) compared with those estimates for patients diagnosed at an earlier stage (P = .048). In subset analyses, the association between the A allele and advanced colorectal cancer was statistically significant in white and Hawaiian participants but not in Japanese, and was stronger for rectal cancer.
Conclusion The CCND1 870A allele may be associated with colorectal cancer, and particularly with forms of the disease that result in severe morbidity and mortality.
INTRODUCTION
Cyclin D1 (CCND1) is a key regulatory protein of the cell cycle, promoting the transition through the restriction point in the G1 phase beyond which the cell is committed to divide.1-2 Overexpression of the CCND1 gene, which has been shown to occur in 30% to 50% of breast and colorectal cancers, has been associated with increased cell proliferation and poor prognosis for a number of human malignancies, including colorectal cancer.3-5 A common adenine-to-guanine (A/G) substitution at nucleotide 870 in the conserved splice donor region of exon 4 has been shown to modulate splicing of CCND1 messenger RNA.6 The G allele preferentially splices transcript a, whereas the A allele mainly splices transcript b, which encodes a protein with a longer half-life.6 The A allele has been associated with poor prognosis for several cancers6-8 and with increased risk of colorectal cancer in hereditary nonpolyposis colorectal cancer families,9 as well as in 2 small hospital-based case-control studies.10-11 Because the A allele is common and may preferentially affect progression, it is important to further clarify its association with colorectal cancer, a neoplasm that is particularly difficult to cure once it has spread outside the intestines. We investigated the association of the CCND1 870A allele with colorectal cancer in a population-based case-control study originally conducted to test gene-diet interactions in the multiethnic population of Hawaii.
METHODS
The participants and data collection methods for this study have been described in detail elsewhere.12-14 Cases were identified through the rapid reporting system of the Hawaii Tumor Registry, a member of the Surveillance Epidemiology and End Results program of the National Cancer Institute. Eligible cases consisted of white, Japanese, or Native Hawaiian residents of the island of Oahu diagnosed with a first adenocarcinoma of the colon or rectum between January 1, 1994, and August 31, 1998. The control group was selected from participants in an ongoing population-based health survey conducted by the Hawaii State Department of Health, which follows a design modeled after that of the National Health Survey.15 For the group aged 65 years or older, this source was supplemented with participants from the Health Care Financing Administration. A control pool was created for each case that agreed on sex, ethnicity, and age (within 2 years); the matched control was randomly selected from the pool. Approval for the study was given by the institutional review board of the University of Hawaii and of each participating hospital. Written informed consent was obtained from each participant. The participation rates were 58% for cases and 52% for controls. Complete questionnaire information was obtained from 727 matched pairs of cases and controls. A blood sample was obtained for 548 cases and 656 controls. Forty-four cases and 32 controls had to be excluded because their DNA had been depleted in genotyping for diet-related genes in the original study; therefore, our study had a total of 504 cases and 624 controls.
The questionnaire was administered during an in-person interview and included detailed information on demographics; a quantitative food-frequency questionnaire; a lifetime history of tobacco, alcohol, and aspirin use; a history of recreational sports activities since age 18 years; a personal history of various relevant medical conditions; a family history of colorectal cancer in parents and siblings; information on height and weight at different ages; and for women, a history of reproductive events and hormone use. The Surveillance Epidemiology and End Results summary staging-information was extracted from the Hawaii Tumor Registry and is defined as follows: in situ tumors (10% of cases) had remained intraepithelial, localized tumors (47%) were confined to the colon or rectum, regional tumors (37%) had either extended through the muscularis to adjacent tissue or metastasized to regional mesenteric lymph nodes, and distant tumors (6%) had metastasized to distant sites.
DNA was extracted from blood lymphocytes using a standard method (QIAamp DNA Blood Midi Kit, Qiagen, Valencia, Calif). Genotyping for CCND1 was performed with forward primer (CCND1F): AGTTCATTTCCAATCCGCCC and reverse primer (CCND1R): TTTCCGTGGCACTAGGTGTC. Polymerase chain reaction conditions consisted of an initial denaturation of 94 °C for 5 minutes, followed up with 35 cycles of 94 °C for 30 seconds, 60 °C for 30 seconds, and 72 °C for 30 seconds, with a final extension of 72 °C for 10 minutes. The resulting 212 base pair (bp) polymerase chain reaction product was digested with the restriction enzyme Moraxella species (MspI) and run on a 3% MetaPhor gel (Cambrex, Rockland, Me), yielding 2 bands for the A allele (175 and 37 bp) and 3 bands for the G allele (141, 37, and 34 bp) (Figure 1).
|
|
|
|
Figure. Electrophoretic Gel Showing the 3 Genotypes for the CCND1 A870G Polymorphism
CCND1 A870G indicates cyclin D1 adenine 870 guanine. Individuals homozygous for the A allele have 1 band at 175 base pair (bp) (lane 4) and those homozygous for the G allele have 1 band at 141 bp (lanes 2 and 5). (The 37 and 34 bp bands are not shown on the gel.) Heterozygous individuals have 2 bands at 175 and 141 bp (lanes 1, 3, and 6). Lane M indicates pGem DNA molecular weight marker from Promega, Madison, Wis. Magenta indicates the A allele associated with poor prognosis for cancer.
|
|
|
The statistical analysis used unconditional logistic regression to compute odds ratios (ORs) and 95% confidence intervals (CIs).16 All models were adjusted for the matching variables (age, sex, and ethnicity) and for potential confounders (pack-years of cigarette smoking, lifetime recreational physical activity [hours], body mass index [calculated as weight in kilograms divided by the square of height in meters] 5 years ago, lifetime use of aspirin [months], years of schooling, and intakes of nonstarch polysaccharides from vegetables and calcium from foods and supplements). Because the ORs were similar in men and women, results are presented for both sexes combined. Gene-dosage effects were modeled by assigning a value of 1, 2, or 3 to the genotype variable according to the number of A alleles (0, 1, and 2 A alleles, respectively). The likelihood ratio test was used to statistically test interaction among certain variables with respect to colorectal cancer. The test compares a main effects no interaction model with a fully parameterized model containing all possible interaction terms for the variables of interest. Polytomous logistic models16 were performed, comparing cases by stage and subsite of cancer to all eligible controls. Such models were used to compare the risk of in situ/localized and regional/distant cancer, and the risk of colon and rectal cancer by stage. The risk between groups was compared statistically by a Wald test.16 Genotype frequencies were tested for deviation from the Hardy Weinberg equilibrium with the 2 test. Statistical significance was defined as P<.05. All analyses were performed with SAS statistical software version 8.2 (SAS Institute Inc, Cary, NC).
RESULTS
The characteristics of colorectal cancer cases and controls are shown in Table 1.12-14 Cases were comparable with controls with regard to age, sex, and ethnicity but were somewhat less educated, more likely to have a family history of colorectal cancer, and less likely to have used aspirin regularly. Cases had smoked more cigarettes and exercised less in their lifetimes. They were also heavier and consumed more calories, less calcium, less folate, and less dietary fiber (measured as nonstarch polysaccharides) from vegetable sources than controls.
|
|
|
|
Table 1. Characteristics of Colorectal Cancer Cases and Controls*
|
|
|
Table 2 presents the distributions of cases and controls with colorectal cancer by CCND1 genotype. Based on the controls, the frequency for the putative high-risk A allele was 0.49, 0.43, and 0.57, in Japanese, white, and Hawaiian participants, respectively. The genotype distributions were consistent with Hardy Weinberg equilibrium in each ethnic group (Japanese, P = .31; white, P = .60; Hawaiian, P = .21). Overall, the A allele was associated with a 30% increase in colorectal cancer risk (OR, 1.3; 95% CI, 1.0-1.7) and the CCND1 870 AA genotype was associated with a 50% increased risk of colorectal cancer (OR, 1.5; 95% CI, 1.0-2.1), with a statistically significant gene-dosage effect (P = .03). This association was suggested similarly in each sex (data not shown) and in white and Hawaiian participants, but not in Japanese. A stronger effect for the A allele was suggested for rectal cancer vs colon cancer. The ORs for the GG, GA, and AA genotypes were 1.0, 1.8 (95% CI, 1.1-2.9), and 2.2 (95% CI, 1.9-3.9), respectively, for rectal cancer (P = .006 for genetic trend) and 1.0, 1.1 (95% CI, 0.8-1.6), and 1.3 (95% CI, 0.9-1.9), respectively, for colon cancer (P = .17 for genetic trend).
|
|
|
|
Table 2. Colorectal Cancer and Ethnicity by CCND1 A870G Genotype*
|
|
|
Table 3 shows the same analysis further stratified by stage of disease at diagnosis with the use of polytomous logistic regression models. The association of the CCNDI 870 AA genotype with an increased risk of colorectal cancer was stronger for advanced stage disease with ORs of 1.7 (95% CI, 1.1-2.5) and 1.9 (95% CI, 1.2-3.1) for the GA and AA genotype, respectively, compared with the GG genotype. This association showed a statistically significant gene-dosage effect (P = .008). In contrast, no statistically significant association was found with the A allele for early-stage colorectal cancer among all participants combined. The OR for the presence of the A allele among patients with advanced colorectal cancer was significantly different from that in patients with early-stage disease (P = .048). In the corresponding race-specific analyses, a nonsignificant association was suggested for early-stage disease in white and Hawaiian participants, and the association with advanced disease was observed or suggested in all ethnic groups. The number of cases with distant stage at diagnosis was too small to allow for separate analyses.
|
|
|
|
Table 3. Colorectal Cancer and CCND1 A870G Genotype by Stage at Diagnosis and Ethnicity*
|
|
|
Table 4 compares the effect of the A allele on colorectal cancer risk stratified by stage at diagnosis and anatomical subsite with the use of polytomous logistic regression. Associations were suggested for the A allele with late-stage colon cancer and early-stage rectal cancer; however, none were statistically significant. The strongest effect for presence vs absence of the A allele was found for late-stage rectal cancer (OR, 2.8; 95% CI, 1.3-6.0), which was also significantly different from the early-stage colon cancer (OR, 1.0; 95% CI, 0.7-1.5; P = .02).
|
|
|
|
Table 4. Colorectal Cancer and CCND1 A870G Genotype by Stage at Diagnosis and Anatomical Subsite*
|
|
|
Analyses for interaction showed no modifying effect of age or family history on the association of the A allele with colorectal cancer.
COMMENT
In this population-based case-control study, we found that the CCND1 870 AA genotype was associated with a 50% increased risk of colorectal cancer, with a statistically significant gene-dosage effect (P = .03). The association with the A allele was significantly stronger for advanced stage disease than for early stage disease. The observed effect was consistent between sexes, across ethnic groups (particularly for advanced disease), and stronger for rectal cancer.
Amplification and/or overexpression of the CCND1 gene have been described in several forms of human cancer and associated with increased cell proliferation and poor prognosis.3-5 With regard to colorectal cancer, overexpression of CCND1 is observed in 30% of the tumors and expression of an antisense to CCND1 complementary DNA has been shown to inhibit the proliferation of human colon cancer cells, as well as their tumorigenicity in nude mice.17 The A870G polymorphism in exon 4 of the CCND1 gene is associated with a splice site variation coding for 2 messenger RNA transcripts.6 Transcript b, which skips exon 5 and reads into intron 4, does not contain the exon 5 destruction box sequence, resulting in a protein with a longer half-life. It has been shown that, although both the A and G alleles encode the 2 transcripts, the A allele preferentially encodes the altered transcript leading to a state of increased CCND1 level, even in the heterozygous state.6, 18
Five previous studies have reported on the association of the CCND1 A870G polymorphism and colorectal cancer. Kong et al9 found that patients with 1 or 2 copies of the CCND1 870A allele who also carry a mutation in a DNA mismatch repair gene develop hereditary nonpolyposis colorectal cancer an average of 11 years earlier than mismatch repair gene mutation carriers with the GG genotype. In contrast, Bala and Peltomäki19 found no correlation between the A allele and age of onset among 146 affected mismatch repair mutation carriers; however, the presence of the variant transcript b in blood or healthy mucosa was associated with a significantly lower age of onset compared with individuals with transcript a only (35 vs 46 years; P = .02). Porter et al11 also showed that the CCND1 870A allele was overrepresented in 107 nonhereditary nonpolyposis colorectal cancer familial cases of colorectal cancer compared with 171 patients without cancer. In the same study, an overrepresentation of the A allele was also observed in 128 "sporadic" colorectal cancer cases, which did not quite reach statistical significance (P = .08). Kong et al10 recently reported on a hospital-based case-control study of 156 white patients with colorectal cancer younger than 60 years and 152 matched-dermatology control patients. Compared with the GG genotype, Kong et al10 found that the AA genotype was associated with an elevated OR of 2.6 (95% CI, 1.4-5.2), whereas the GA genotype was unrelated to risk (OR, 1.1; 95% CI, 0.6-1.8). Finally, in a hospital-based study of 100 patients and 101 blood donors, McKay et al5 reported a lack of association between the CCND1 870A allele and colorectal cancer; however, survival was significantly shorter in patients with a high level of CCND1 expression in their tumors (>50% cells demonstrating immunoreactivity). Overall, these past studies, which were hospital-based and relatively small, were suggestive of a possible association of the CCND1 G870A allele with progression of colorectal tumors.
Our study expands these findings with a population-based design and a larger sample size. We also report ethnicity, which has not been studied before. The A allele is particularly common in Native Hawaiians, a group of patients who often present at a late stage and experience a poorer stage-adjusted cause-specific survival for various cancers, including colorectal cancer, compared with white patients.20-21 Similarly, the weaker effect for the A allele observed among Japanese participants in this study would, if confirmed, be consistent with the early presentation and better cause-specific survival of Japanese patients with colorectal cancer in Hawaii.20-21 Colorectal cancer is rarely curable when the disease has spread outside the large intestine. Given the high frequency of the A allele (0.43-0.57 in the 3 ethnic groups) and the stronger association for advanced disease, this polymorphism may be responsible for a sizable portion of the morbidity and mortality from colorectal cancer. If confirmed, this association may have implications for the colorectal cancer screening and treatment of the A allele carriers.
Other methodological aspects of our study deserve consideration. Differences in detection rate by genotype appears to be an unlikely explanation for our results because the association was observed in 2 ethnic groups with markedly different socioeconomic status and screening practices.21-22 This is reflected in the proportions of in situ tumors in our population-based case-series (Japanese, 10%; white, 9%; Hawaiian, 4%). Confounding by other variables is also unlikely because the effects of known risk factors were thoroughly investigated in the analysis. The association was observed in several ethnic groups, arguing against residual confounding by ethnicity. Moreover, the frequency of the CCND1 870A allele in our white control participants (0.43) is very similar to that from previous reports,10-11 and the genotype frequencies were in Hardy Weinberg equilibrium, arguing against selection bias. This is consistent with the fact that characteristics of participants who gave blood were very similar to those of all interviewed participants in this study.13
In conclusion, these data provide strong evidence that the CCND1 870A allele may be associated with colorectal cancer, and particularly with forms of the disease that result in severe morbidity and mortality.
AUTHOR INFORMATION
 |  |
Corresponding Author and Reprints: Loïc Le Marchand, MD, PhD, Etiology Program, Cancer Research Center of Hawaii, University of Hawaii, 1236 Lauhala St, Suite 407, Honolulu, HI 96813 (e-mail: loic{at}crch.hawaii.edu).
Author Contributions: Dr Le Marchand had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.
Study concept and design: Le Marchand, Donlon, Wilkens.
Acquisition of data: Le Marchand, Seifried, Lun-Jones, Wilkens.
Analysis and interpretation of data: Le Marchand, Lun-Jones, Wilkens.
Drafting of the manuscript: Le Marchand, Donlon, Wilkens.
Critical revision of the manuscript for important intellectual content: Le Marchand, Seifried, Lun-Jones, Wilkens.
Statistical expertise: Le Marchand, Wilkens.
Obtained funding: Le Marchand.
Administrative, technical, or material support: Le Marchand, Seifried, Lun-Jones, Donlon.
Study supervision: Le Marchand.
Funding/Support: This study was supported by grants R01 CA60987 and CA72520, and contract N01-CN55424 from the National Cancer Institute, US Department of Health and Human Services.
Role of the Sponsor: The National Cancer Institute and the collaborating hospitals did not participate in the design and conduct of the study, in the collection, analysis, and interpretation of the data, or in the preparation, review, or approval of the manuscript.
Disclaimer: The content of this article is solely the responsibility of the authors and does not necessarily represent the official views or policies of the participating institutions.
Acknowledgment: We thank the Hawaii Tumor Registry, Castle Medical Center, Kaiser-Permanente Medical Center, Kuakini Medical Center, Queen's Medical Center, Straub Clinic and Hospital, St Francis Medical Center, and Wahiawa General Hospital for their collaboration. We also thank Aleli Vinoya, BS, and Jennifer Yamamoto, BS, for assistance with data analysis.
Author Affiliations: Cancer Research Center of Hawaii, University of Hawaii, Honolulu.
REFERENCES
1. Sherr CJ. Cancer cell cycle. Science. 1996;274:1672-1677.
FREE FULL TEXT
2. Musgrove EA, Lee CSL, Buckley MF, Sutherland RL. Cyclin D1 induction in breast cancer cells shorten G1 and is sufficient for cells arrested in G1 to complete the cell cycle. Proc Natl Acad Sci U S A. 1994;91:8022-8026.
FREE FULL TEXT
3. Holley SL, Parkes G, Matthias C, et al. Cyclin D1 polymorphism and expression in patients with squamous cell carcinoma of the head and neck. Am J Pathol. 2001;159:1917-1924.
FREE FULL TEXT
4. Arber N, Hibshoosh H, Moss SF, et al. Increased expression of cyclin D1 is an early event in multistage colorectal carcinogenesis. Gastroenterology. 1996;110:669-674.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
5. McKay JA, Douglas JJ, Ross VG, et al, for the Aberdeen Colorectal Initiative. Cyclin D1 protein expression and gene polymorphism in colorectal cancer. Int J Cancer. 2000;88:77-81.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
6. Betticher DC, Thatcher N, Altermatt HJ, et al. Alternated splicing produces a novel cyclin D1 transcript. Oncogene. 1995;11:1005-1011.
WEB OF SCIENCE
| PUBMED
7. Zheng Y, Shen H, Sturgis EM, et al. Cyclin D1 polymorphism and risk for squamous cell carcinoma of the head and neck: a case-control study. Carcinogenesis. 2001;22:1195-1199.
FREE FULL TEXT
8. Wang L, Habuchi T, Takahashi T, et al. Cyclin D1 gene polymorphism is associated with an increased risk of urinary bladder cancer. Carcinogenesis. 2002;23:257-264.
FREE FULL TEXT
9. Kong S, Amos CI, Luthra R, et al. Effects of cyclin D1 polymorphism on age of onset of hereditary nonpolyposis colorectal cancer. Cancer Res. 2000;60:249-252.
FREE FULL TEXT
10. Kong S, Wei Q, Amos CI, et al. Cyclin D1 polymorphism and increased risk of colorectal cancer at young age. J Natl Cancer Inst. 2001;93:1106-1108.
FREE FULL TEXT
11. Porter TR, Richards FM, Houlston RS, et al. Contribution of cyclin D1 (CCND1) and E-cadherin (CDH1) polymorphisms to familial and sporadic colorectal cancer. Oncogene. 2002;21:1928-1933.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
12. Le Marchand L, Hankin JH, Wilkens LR, et al. Combined effect of well-done red meat, smoking and rapid NAT2 and CYP1A2 phenotypes in increasing colorectal cancer risk. Cancer Epidemiol Biomarkers Prev. 2001;10:1259-1266.
FREE FULL TEXT
13. Le Marchand L, Donlon T, Hankin JH, et al. B-vitamin intake, metabolic genes and colorectal cancer risk. Cancer Causes Control. 2002;13:239-248.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
14. Le Marchand L, Donlon T, Seifried A, et al. Association of a common polymorphism in the human GH-1 gene and colorectal neoplasia. J Natl Cancer Inst. 2002;94:454-460.
FREE FULL TEXT
15. Oyama N, Johnson DB. Hawaii Health Surveillance Program Survey Methods and Procedures. Honolulu, Hawaii: Hawaii State Department of Health, Research and Statistics Office; 1986. Research and Statistics Report No. 54.
16. Hosmer DW, Lemeshow S. Applied Logistic Regression. New York, NY: John Wiley & Sons; 1989.
17. Arber N, Doki Y, Han EK, et al. Antisense to cyclin D1 inhibits the growth and tumorigenicity of human colon cancer cells. Cancer Res. 1997;57:1569-1574.
FREE FULL TEXT
18. Izzo JG, Vassiliki A, Papadimitrakopoulou VA, et al. Cyclin D1 genotype, response to biochemoprevention, and progression rate to upper aerodigestive tract cancer. J Natl Cancer Inst. 2003;95:198-205.
FREE FULL TEXT
19. Bala S, Peltomäki P. CYCLIN D1 as a genetic modifier in hereditary nonpolyposis colorectal cancer. Cancer Res. 2001;61:6042-6045.
FREE FULL TEXT
20. Wegner EL, Kolonel LN, Nomura AMY, Lee J. Racial and socioeconomic status differences in survival of colorectal cancer patients in Hawaii. Cancer. 1982;49:2208-2216.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
21. Pagano IS, Morita SY, Dhakal S, et al. Time dependent ethnic convergence in colorectal cancer survival in Hawaii. BMC Cancer. 2003;3:5.
FULL TEXT
| PUBMED
22. Hawaii State Department of Health Behavioral Risk Factor Surveillance System, 2002. Available at: http://www.hawaii.gov/health/stats/surveys/2002/hadsig50.html. Accessibility verified October 27, 2003.
CiteULike Connotea Del.icio.us Digg Reddit Technorati Twitter
What's this?
THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES
 |
Nuclear Receptor Coregulators in Cancer Biology
O'Malley and Kumar
Cancer Res. 2009;69:8217-8222.
ABSTRACT
| FULL TEXT
Breast Cancer and Cyclin D1 Gene Polymorphism in Turkish Women
YAYLIM-ERALTAN et al.
In Vivo 2009;23:767-772.
ABSTRACT
| FULL TEXT
Association between CCND1 G/A870 Polymorphism, Allele-Specific Amplification, Cyclin D1 Expression, and Survival in Esophageal and Lung Carcinoma
Gupta et al.
Clin. Cancer Res. 2008;14:7804-7812.
ABSTRACT
| FULL TEXT
Cyclin D1 Pro241Pro (CCND1-G870A) Polymorphism Is Associated with Increased Cancer Risk in Human Populations: A Meta-Analysis
Pabalan et al.
Cancer Epidemiol. Biomarkers Prev. 2008;17:2773-2781.
ABSTRACT
| FULL TEXT
Association of cyclin D1 G870A polymorphism with uterine leiomyoma in women whose body mass index values are above 25 kg/m2
Han et al.
Hum Reprod 2008;23:525-529.
ABSTRACT
| FULL TEXT
Genetic Variants in Cell Cycle Control Pathway Confer Susceptibility to Lung Cancer
Wang et al.
Clin. Cancer Res. 2007;13:5974-5981.
ABSTRACT
| FULL TEXT
The effect of the cyclin D1 (CCND1) A870G polymorphism on colorectal cancer risk is modified by glutathione-S-transferase polymorphisms and isothiocyanate intake in the Singapore Chinese Health Study
Probst-Hensch et al.
Carcinogenesis 2006;27:2475-2482.
ABSTRACT
| FULL TEXT
Cyclin D1 gene polymorphism as a risk factor for oral premalignant lesions
Huang et al.
Carcinogenesis 2006;27:2034-2037.
ABSTRACT
| FULL TEXT
The effect of cyclin D1 (CCND1) G870A-polymorphism on breast cancer risk is modified by oxidative stress among Chinese women in Singapore
Ceschi et al.
Carcinogenesis 2005;26:1457-1464.
ABSTRACT
| FULL TEXT
Association of Cyclin D1 Genotype with Breast Cancer Risk and Survival
Shu et al.
Cancer Epidemiol. Biomarkers Prev. 2005;14:91-97.
ABSTRACT
| FULL TEXT
Minireview: Cyclin D1: Normal and Abnormal Functions
Fu et al.
Endocrinology 2004;145:5439-5447.
ABSTRACT
| FULL TEXT
An update on the genetics of colorectal cancer
Kemp et al.
Hum Mol Genet 2004;13:R177-R185.
ABSTRACT
| FULL TEXT
The emergence of epidemiology in the genomics age
Khoury et al.
Int J Epidemiol 2004;33:936-944.
FULL TEXT
|