 |
 |

Methods to Increase the Percentage of Free Fetal DNA Recovered From the Maternal Circulation
Ravinder Dhallan, MD, PhD;
Wei-Chun Au, PhD;
Subhendra Mattagajasingh, PhD;
Sarah Emche, PhD;
Philip Bayliss, MD;
Marian Damewood, MD;
Michael Cronin, PhD;
Victoria Chou, MS;
Michelle Mohr, MS
JAMA. 2004;291:1114-1119.
ABSTRACT
 |  |
Context Noninvasive prenatal diagnostic tests using free fetal DNA provide an alternative to invasive tests and their attendant risks; however, free fetal DNA exists in the maternal circulation at low percentages, which has hindered development of noninvasive tests.
Objective To test the hypothesis that using formaldehyde to reduce cell lysis could increase the relative percentage of free fetal DNA in samples of maternal blood.
Design, Setting, and Patients The first phase of the study was conducted from January through February 2002 at a single US clinical site; 2 samples of blood were collected from each of 10 pregnant women, and the percentage of free fetal DNA in formaldehyde-treated and untreated samples was determined. The second phase of the study was conducted from March 2002 through May 2003, and measured the percentage of free fetal DNA in 69 formaldehyde-treated samples of maternal blood obtained from a network of 27 US clinical sites in 16 states.
Main Outcome Measure Percentage of free fetal DNA in samples of maternal blood.
Results In the first phase of the study, the mean percentage of free fetal DNA in the untreated samples was 7.7% (range, 0.32%-40%), while the mean percentage of free fetal DNA in the formaldehyde-treated samples was 20.2% (range, 1.6%-40%) (P = .02 for difference). In the second phase, a median of 25% (range, 3.1% to >50%) free fetal DNA was obtained for the 69 formaldehyde-treated maternal blood samples. Approximately 59% of the samples in this study had 25% or greater fetal DNA, and only 16% of the samples had less than 10% fetal DNA. In addition, 27.5% of the samples in this study had 50% or greater fetal DNA.
Conclusion Addition of formaldehyde to maternal blood samples, coupled with careful processing protocols, increases the relative percentage of free fetal DNA, providing a foundation for development of noninvasive prenatal diagnostic tests to distinguish fetal DNA from maternal DNA in the maternal circulation.
INTRODUCTION
Prenatal diagnosis is useful for managing a pregnancy with an identified fetal abnormality and may allow for planning and coordinating care during delivery and the neonatal period.1 A variety of prenatal diagnostic tests are available but have limitations. Noninvasive tests such as maternal serum marker testing and ultrasound can be used to screen for the presence of chromosomal abnormalities but are not definitive.2-5 On the other hand, invasive diagnostic tests (eg, amniocentesis, chorionic villus sampling, percutaneous umbilical blood sampling) for fetal chromosomal abnormalities are highly reliable, but the procedure used for each test carries a risk for loss of pregnancy.6-7 Many patients who are candidates for these tests decline them because of the risk of pregnancy loss.
An alternative to existing methods for prenatal diagnosis is to use fetal cells and fetal DNA that exist in the maternal circulation.8-15 Circulating fetal DNA has been used to determine the sex of the fetus through detection of sequences present on the Y chromosome.13 In addition, several studies have attempted to use free fetal DNA to screen for chromosomal abnormalities in the fetus.16-21 However, the use of free fetal DNA for detecting chromosomal abnormalities has been limited by the seemingly low percentage of free fetal DNA in the maternal circulation. Lo et al13 reported a mean of 3.4% free fetal DNA in maternal plasma in the late first to the mid second trimester and a mean of 6.2% free fetal DNA in the late third trimester. Any method that can increase the relative percentage of free fetal DNA in the sample would make it easier to distinguish fetal DNA from maternal DNA. Noninvasive prenatal diagnostic tests that are DNA-based would benefit from higher percentages of free fetal DNA in the samples.
We hypothesized that inhibiting cell lysis during sample collection, shipping, handling, and processing would permit the recovery of a larger percentage of free fetal DNA. By decreasing the amount of maternal cell lysis, and thus the amount of free maternal DNA, the relative percentage of free fetal DNA likely can be increased.
METHODS
Blood samples were collected from women carrying a male or a female fetus; however, the majority of samples (81 of 85 [95.3%]) analyzed were obtained from women carrying a male fetus. The Y chromosome is the accepted marker for quantitating percentages of fetal DNA. Each clinical site received institutional review board approval for participation in this research protocol. All women were aged 18 years or older, had a singleton pregnancy, and provided written informed consent prior to enrollment.
Collection of Blood Samples
First Phase. The first phase of this study was conducted from January through February 2002, and recruited women pregnant with a male fetus (identified by ultrasound). Blood samples were collected from the women at a single clinical site prior to an amniocentesis procedure. Two tubes of blood (9 mL in each tube) were collected from each of 10 women. One tube was treated with 0.225 mL of a 10% neutral buffered solution containing formaldehyde (4% weight per volume) (Sigma, St Louis, Mo), a chemical that stabilizes cell membranes and impedes cell lysis. The other tube was left untreated. The tubes were assigned a numerical code and hand-delivered to our facility for analysis. Laboratory personnel were blinded as to which specimens contained formaldehyde.
Second Phase. For the second phase of the study, conducted from March 2002 through May 2003, a network of 27 clinical sites, operating in 16 states in the United States, was established to collect formaldehyde-treated blood samples from pregnant women prior to amniocentesis or chorionic villus sampling. Seventy-one samples from women carrying a male fetus and 4 samples from women carrying a female fetus were analyzed in this phase of the study. Fetal sex was confirmed by amniocentesis or chorionic villus sampling report. Each sample was coded so that laboratory personnel did not know whether it was obtained from a woman carrying a male or a female fetus.
All samples collected in the second phase of the study were treated with formaldehyde. The clinical sites were provided with a kit used for the venipuncture procedure, which included 21-gauge needles, 9-mL EDTA blood collection tubes, a syringe for each tube containing 0.225 mL of a 10% neutral buffered solution containing formaldehyde (4% weight per volume), an ice pack, and a shipping container. The clinical sites were instructed to add the formaldehyde to the tubes and gently invert them immediately after blood was drawn. The specimens were shipped by commercial carrier for overnight delivery to our facility.
Isolation of Plasma and DNA
The protocols for isolation of plasma were optimized to reduce cell lysis. Tubes were centrifuged at 200g for 10 minutes with the brake and acceleration powers set to zero. Tubes then were centrifuged at 1600g for 10 minutes with the brake and acceleration powers set to zero. The supernatant (ie, the plasma) of each sample was transferred to a new tube and spun at 1600g for 10 minutes with the brake and acceleration powers set to zero. The plasma was transferred carefully to a new tube and stored at -80°C. Approximately 0.5 mL of supernatant was left in the tube to ensure that the buffy coat was not disturbed.
DNA was isolated from plasma samples using the QIAamp DNA Blood Midi Kit (Qiagen, Valencia, Calif) for purification of DNA from blood cells, according to the manufacturer's instructions. DNA was eluted in 100 µL of distilled water.
Primer Design
Two sets of primers were used: 1 set amplified the sex-determining region Y gene (SRY), which is located on the Y chromosome and is thus representative of fetal DNA, and the other set amplified the cystic fibrosis gene (CYS), which is present on both maternal template DNA and fetal template DNA. Unique regions of the SRY gene and the CYS gene were identified by sequence searches using the Blast program available from the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov).
The following primers were designed to amplify the SRY gene: upstream primer: 5' TGGCGATTAAGTCAAATTCGC 3'; downstream primer: 5' CCCCCTAGTACCCTGACAATGTATT 3'. The following primers were designed to amplify the CYS gene: upstream primer: 5' CTGTTCTGTGATATTATGTGTGGT 3'; downstream primer: 5' AATTGTTGGCATTCCAGCATTG 3'.
Gene Amplification
The SRY gene and the CYS gene were amplified from plasma free DNA by polymerase chain reaction (PCR) using the HotStarTaq Master Mix kit (Qiagen). Each PCR reaction used 8 µL of template DNA (diluted or undiluted), 1 µL of each primer (5 µM), and 10 µL of HotStarTaq mix. The following PCR conditions were used: (1) 95°C for 15 minutes, (2) 94°C for 30 seconds, (3) 54°C for 15 seconds, (4) 72°C for 30 seconds, (5) repeat steps 2 through 4 for 45 cycles, and (6) 72°C for 10 minutes.
Quantification of Fetal DNA
The percentage of free fetal DNA in the maternal plasma sample was determined by PCR using serially diluted plasma DNA, which accurately quantifies the number of genomes that harbor the amplified gene. For example, if the blood sample contains 100% male fetal DNA, and 1:2 serial dilutions are performed, then on average the SRY signal will disappear 1 dilution before the CYS signal, since there is 1 copy of the SRY gene and 2 copies of the CYS gene.
The percentage of free fetal DNA in the maternal plasma was calculated using the following formula: percentage of free fetal DNA = (No. of copies of SRY gene x 2 x 100)/(No. of copies of CYS gene), where the number of copies of each gene was determined by observing the highest serial dilution in which the gene was detected. The formula contains a multiplication factor of 2, which is used to normalize for the fact that there is only 1 copy of the SRY gene.
In the first phase of the study, 6 serial dilutions (1:5) were performed for each sample (1:5 to 1:15625). Provided that there is at least 1 copy of the SRY gene and that the CYS gene is detected in the sixth serial dilution, the lowest possible value is 0.0128% free fetal DNA ([1 x 2 x 100]/15625). All other values increase by multiples of 5 from 0.0128, depending on the number of dilutions that were positive for the SRY and CYS genes (eg, 0.064, 0.32, 1.6, 8, and 40).
In the second phase of the study, 10 serial dilutions (1:2) were performed for each sample (1:2 to 1:1024). Provided that there is at least 1 copy of the SRY gene and that the CYS gene is detected in the 10th serial dilution, the lowest possible value is 0.1953% free fetal DNA ([1 x 2 x 100]/1024). All other values increase by multiples of 2 from 0.1953.
The number of fetal genomes per milliliter of plasma was calculated using the following formula: No. of genomes/mL of plasma = (No. of copies of SRY gene/volume of DNA in reaction [µL]) x (volume of DNA eluted [µL]/total volume of plasma through column [mL]).
Statistical Analysis
The primary outcome in the first phase of the study was the difference in the percentage of free fetal DNA between formaldehyde-treated and untreated samples. The nonparametric Wilcoxon signed rank test, which assumes that there is information in the magnitude of differences, was used to analyze the data from the first phase of the study. All analyses were performed using Analyse-it General & Clinical Laboratory Statistics, version 1.71 (Analyse-it Software Ltd, Leeds, England); P<.05 was used to determine statistical significance.
RESULTS
First Phase
The results from the first phase of the study are summarized in Table 1. Analysis of the untreated samples revealed a mean of 7.7% (range, 0.32%-40%) free fetal DNA. The formaldehyde-treated samples had a mean of 20.2% (range, 1.6%-40%) free fetal DNA.
|
|
|
|
Table 1. Effects of Formaldehyde on Percentage of Free Fetal DNA Recovered From Maternal Plasma Samples
|
|
|
Several of the untreated samples (from participants 1, 3, 4, and 10) contained percentages of free fetal DNA that were substantially below the median. Even with these samples, the addition of formaldehyde increased the relative percentage of free fetal DNA. For instance, in untreated samples from participants 4 and 10, the percentage of free fetal DNA was 0.32%, whereas in foraldehyde-treated samples collected from the same women the percentage of free fetal DNA was increased to 8%.
In 3 of the samples (from participants 2, 6, and 7), there was no measurable effect of formaldehyde on the percentage of free fetal DNA. However, analysis of the paired samples from the first phase of the study using the Wilcoxon signed rank test revealed that, overall, the addition of formaldehyde significantly increased the percentage of free fetal DNA (P = .02; W = 28 for y = 7).
Second Phase
Because analysis of the samples from the first phase of the study revealed that the effect of formaldehyde was statistically significant, the second phase of the study was designed to evaluate the percentage of free fetal DNA in formaldehyde-treated samples in a larger patient population from multiple clinical sites. A total of 75 samples from pregnant women were collected in this phase of the study. Seventy-one samples were collected from women who carried a male fetus. However, 2 samples were excluded from analysis because these samples were not received within 24 hours after collection.
Four samples were obtained from women who carried a female fetus. For each of these samples, a robust signal was observed for the CYS gene; as expected, no signal was detected for the SRY gene, which is specific for the Y chromosome.
Analysis of the 69 formaldehyde-treated samples revealed a median of 25% (range, 3.1% to >50%) free fetal DNA (Table 2). Approximately 16.0% of the samples (11/69) had less than 10% free fetal DNA; approximately 59% of the formaldehyde-treated samples had 25% or greater free fetal DNA and 27.5% of the samples had 50% or greater free fetal DNA (4 [5.8% of total] samples had 3.1% free fetal DNA; 7 [10.1%] had 6.2%; 17 [24.6%] had 12.5; 22 [31.9%] had 25%; 8 [11.6%] had 50%; and 11 [15.9%] had >50%). Although many of the formaldehyde-treated samples contained high percentages of free fetal DNA, there was variability in the percentages obtained.
|
|
|
|
Table 2. Number of Fetal Genomes and Percentage of Free Fetal DNA in Formaldehyde-Treated Blood Samples Collected at Various Weeks of Gestation From Women Carrying Male Fetuses
|
|
|
Analysis of the formaldehyde-treated samples also revealed a mean of 66.1 fetal genomes/mL of plasma, with a range of 3.0 fetal genomes/mL to 533 fetal genomes/mL (Table 2). Some of the samples (eg, sample 12) had a limited number of fetal genomes but a high percentage of fetal DNA. Conversely, some samples had an ample number of fetal genomes but a lower percentage of fetal DNA. For instance, sample 40 had 112.5 fetal genomes/mL but the percentage of fetal DNA was 6.2% (Table 2).
COMMENT
We have shown that the relative percentage of free fetal DNA recovered from maternal blood samples can be increased. Addition of formaldehyde to maternal blood samples, coupled with careful processing protocols, resulted in an increase in the percentage of free fetal DNA recovered from the maternal circulation. This increase in the relative percentage of free fetal DNA likely resulted from a combination of factors.
First, formaldehyde stabilizes cell membranes, thereby preventing cell lysis and the release of DNA. Prior to the venipuncture procedure, the amount of free maternal DNA in the maternal circulation likely is low. However, the maternal cells may lyse during sample collection, shipping, handling, and processing. For example, during centrifugation the cells are exposed to gravitational forces, which may rupture cells. The presence of formaldehyde protects the cells from lysis.
Second, the addition of formaldehyde may allow a larger recovery of free fetal DNA by inhibiting enzymes that destroy DNA, such as DNases. For the samples analyzed in the second phase of the study, a mean of 66.1 fetal genomes/mL was obtained, which represents a 2.6-fold increase over the mean reported in the literature (25.4 fetal genomes/mL).13 Inhibition of enzymes that destroy DNA would permit a larger recovery of DNA (including free fetal DNA) already present in the sample. Also, the addition of formaldehyde may stabilize and preserve the structure of DNA, which may increase the amount of DNA recovered.
Third, in conjunction with the addition of formaldehyde to the maternal blood samples, sample-processing protocols designed to minimize cell lysis likely contributed to increases in the percentage of free fetal DNA. A centrifugation protocol was designed to minimize gravitational forces imposed on the cells. Samples initially were spun at a low speed, which allowed the majority of cells to separate from the plasma under minimal forces. In addition, all centrifugation steps were performed with the acceleration and brake powers set to zero. This reduced the formation of a vortex during centrifugation, minimizing mixing of the plasma and the buffy coat, which contains maternal cellular material. Also, when removing the plasma sample, care was taken to ensure that the buffy coat was not disturbed.
A larger study would be useful to delineate factors contributing to the results presented in this study, and to understand why some samples have a higher percentage of free fetal DNA than others. For instance, in 3 samples from the first phase of the study, there was no measurable effect of formaldehyde on the percentage of free fetal DNA. It is possible that formaldehyde was not added or mixed properly with the treated samples or may have been added to both treated and untreated samples.
Also, in some samples there may be a greater amount of free maternal DNA already present in the maternal circulation. While the addition of formaldehyde will impede cell lysis that occurs during sample collection, shipping, handling, and processing, it likely will not reduce the concentration of free maternal DNA already present in the sample. A larger study comparing the percentage of free fetal DNA in formaldehyde-treated and untreated samples will help to address these issues.
Furthermore, several controllable factors likely contribute to the variation in the percentages of free fetal DNA. One such factor is the time interval between the venipuncture procedure and sample processing. The shorter this time interval the more likely it is the integrity of the sample will be preserved and cell lysis kept to a minimum. Similarly, the length of time between the venipuncture procedure and the addition of formaldehyde is thought to be critical. If formaldehyde is not added shortly after the venipuncture procedure, cells may lyse and release DNA. Also, it is important that the formaldehyde is gently mixed throughout the tube to allow maximum exposure to the reagent.
With an increased percentage of free fetal DNA in the maternal blood samples, the sequence of fetal DNA can be discerned from maternal DNA using natural genetic markers, such as single nucleotide polymorphisms. For example, at certain genomic sites, the maternal genome will be homozygous for allele A, while the paternal genome is homozygous for allele B, which means the fetal genome will be heterozygous at this genomic site. Allele B represents a distinct fetal signal in the maternal blood sample. The detection and quantitation of fetal DNA, in this case allele B, is more attainable with an increased percentage of fetal DNA, and can be used to diagnose single-gene disorders and chromosomal abnormalities.
A ratio for alleles A and B can be quantitated and used to detect chromosomal disorders. When samples have a high percentage of free fetal DNA, the difference between the expected ratio of the chromosomes for a healthy fetus and that for an abnormal fetus is greater, which makes it easier to diagnose chromosomal abnormalities. Thus, the methods described herein for increasing the percentage of free fetal DNA provide a solid foundation for the development of a noninvasive prenatal diagnostic test.
AUTHOR INFORMATION
 |  |
Corresponding Author: Ravinder Dhallan, MD, PhD, Ravgen Inc, 9241 Rumsey Rd, Columbia, MD 21045 (rdhallan{at}ravgen.com).
Author Contributions: Dr Damewood had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analyses.
Study concept and design: Dhallan, Bayliss.
Acquisition of data: Au, Mattagajasingh, Emche, Bayliss, Chou, Mohr.
Analysis and interpretation of data: Dhallan, Au, Mattagajasingh, Damewood, Cronin.
Drafting of the manuscript: Dhallan, Au, Mattagajasingh, Emche, Bayliss, Cronin, Chou, Mohr.
Critical revision of the manuscript for important intellectual content: Dhallan, Bayliss, Damewood, Cronin.
Statistical expertise: Dhallan, Damewood.
Obtained funding; study supervision: Dhallan.
Administrative, technical, or material support: Dhallan, Au, Mattagajasingh, Emche, Bayliss, Damewood, Cronin, Chou, Mohr.
Funding/Support: This study was financed in its entirety by Ravgen Inc.
Role of the Sponsor: Ravgen Inc designed and executed the study and drafted and submitted the manuscript.
Disclaimer: Participation in the study is not an endorsement of any service or product offered by Ravgen Inc.
Acknowledgment: We thank the following physicians and their associated staff who took the time and effort to participate in this study: Jeffrey Boyle, MD, Robert H. Debbs, DO, Eric Dellinger, MD, Adam J. Duhl, MD, Andrew Garber, MD, Sheri Hamersley, MD, Gina Hanna, MD, Cathleen Harris, MD, MPH, Kimberly Heller, MD, James W. Hole, DO, Brian K. Iriye, MD, Jon Katz, MD, Carolyn Kline, MD, MPH, Janet Larson, MD, Harvey Lederman, MD, Sanford M. Lederman, MD, Glenn Markenson, MD, Arthur S. Maslow, DO, A. George Neubert, MD, William Polzin, MD, Uma Reddy, MD, Cesar Rosa, MD, Thomas F. Rowe, MD, Orion Rust, MD, Anthony B. Royek, MD, Luis R. Saldana, MD, Carl Saphier, MD, Richard K. Silver, MD, and Joseph Wax, MD. We thank King-Wai Yau, PhD, for his analysis of the data, and for his thoughts and guidance regarding the presentation of the data. We thank Susan Higgins for administrative support, and Amartya Basu, BS, for assistance with data analysis.
Financial Disclosures: Dr Dhallan is the founder, chief executive officer, and chairman of the board of and a stockholder in Ravgen Inc. Drs Au, Mattagajasingh, Emche, and Cronin and Ms Chou are employed by and have options to purchase stock in Ravgen. At the time of her participation in the study, Ms Mohr was employed by Ravgen, and she currently is a stockholder in Ravgen. Dr Bayliss is a member of the board of directors of and has options to purchase stock in Ravgen. Dr Damewood is an unpaid member of the advisory board of and has options to purchase stock in Ravgen. Ravgen has filed for patents for the methodology described in this article.
Author Affiliations: Ravgen Inc, Columbia, Md (Drs Dhallan, Au, Mattagajasingh, Emche, and Cronin and Mss Chou and Mohr); Department of Obstetrics and Gynecology, York Hospital, York, Pa (Drs Bayliss and Damewood). Dr Bayliss currently is affiliated with the Department of Maternal Fetal Medicine, Lancaster General Women & Babies Hospital, Lancaster, Pa.
REFERENCES
1. Lowry DL, Campbell SA, Krivchenia EL, et al. Impact of abnormal second-trimester maternal serum single, double, and triple screening on patient choices about prenatal diagnosis. Fetal Diagn Ther. 1995;10:286-289.
ISI
| PUBMED
2. Summers AM, Huang T, Meier C, et al. The implications of a false positive second-trimester serum screen for Down Syndrome. Obstet Gynecol. 2003;101:1301-1306.
FULL TEXT
|
ISI
| PUBMED
3. Meier C, Huang T, Wyatt PR, et al. Accuracy of trisomy 18 screening using the second-trimester test. Prenat Diagn. 2003;23:443-446.
FULL TEXT
|
ISI
| PUBMED
4. Loncar J, Barnabei VM, Larsen JW. Advent of maternal serum markers for Down syndrome screening. Obstet Gynecol Surv. 1995;50:316-320.
FULL TEXT
| PUBMED
5. MacDonald ML, Wagner RM, Slotnick RN. Sensitivity and specificity of screening for Down syndrome with alpha-fetoprotein, hCG, unconjugated estriol and maternal age. Obstet Gynecol. 1991;77:63-68.
ISI
| PUBMED
6. Alfirevic Z, Sundberg K, Brigham S. Amniocentesis and chorionic villus sampling for prenatal diagnosis. Cochrane Database Syst Rev. 2003;3:CD003252.
PUBMED
7. d'Ercole C, Shojai R, Desbriere R. Prenatal screening: invasive diagnostic approaches. Childs Nerv Syst. 2003;19:444-447.
FULL TEXT
|
ISI
| PUBMED
8. Walknowska J, Conte FA, Grumbach MM. Practical and theoretical implications of fetal-maternal lymphocyte transfer. Lancet. 1969;1:1119-1122.
FULL TEXT
|
ISI
| PUBMED
9. Kamm RC, Smith AG. Nucleic acid concentrations in normal human plasma. Clin Chem. 1972;18:519-522.
ABSTRACT
10. Cox RA, Gokcen M. Circulating DNA levels in man. Biochem Med. 1976;15:126-137.
FULL TEXT
|
ISI
| PUBMED
11. Lo YMD, Patel P, Wainscoat JS, et al. Prenatal sex determination by DNA amplification from maternal peripheral blood. Lancet. 1989;2:1363-1365.
ISI
| PUBMED
12. Lo YMD, Tein MSC, Lau TK, et al. Presence of fetal DNA in maternal plasma and serum. Lancet. 1997;350:485-487.
FULL TEXT
|
ISI
| PUBMED
13. Lo YMD, Tein MSC, Lau TK, et al. Quantitative analysis of fetal DNA in maternal plasma and serum: implications for noninvasive prenatal diagnosis. Am J Hum Genet. 1998;62:768-775.
FULL TEXT
|
ISI
| PUBMED
14. Lo YMD. Fetal DNA in maternal plasma: biology and diagnostic applications. Clin Chem. 2000;46:1903-1906.
FREE FULL TEXT
15. Pertl B, Bianchi DW. Fetal DNA in maternal plasma: emerging clinical applications. Obstet Gynecol. 2001;98:483-490.
FULL TEXT
|
ISI
| PUBMED
16. Wataganara T, LeShane ES, Farina A, et al. Maternal serum cell-free fetal DNA levels are increased in cases of Trisomy 13 but not 18. Hum Genet. 2003;112:204-208.
ISI
| PUBMED
17. Skinner J, Luettich K, Ring M, et al. Analysis of fetal DNA in the maternal venous blood for abnormalities of chromosomes 13, 16, 18, and 21 in first-trimester spontaneous miscarriage. J Obstet Gynaecol. 2003;23:228-232.
FULL TEXT
| PUBMED
18. Samura O, Sohda S, Johnson KL, et al. Diagnosis of trisomy 21 in fetal nucleated erythrocytes from maternal blood by use of short tandem repeat sequences. Clin Chem. 2001;47:1622-1626.
FREE FULL TEXT
19. Poon LLM, Leung TN, Lau TK, et al. Prenatal detection of fetal Down's syndrome from maternal plasma. Lancet. 2000;356:1819-1820.
FULL TEXT
|
ISI
| PUBMED
20. Lo YMD, Lau TK, Zhang J, et al. Increased fetal DNA concentrations in the plasma of pregnant women carrying fetuses with trisomy 21. Clin Chem. 1999;45:1747-1751.
FREE FULL TEXT
21. Verma L, Macdonald F, Leedham P, et al. Rapid and simple prenatal DNA diagnosis of Down's syndrome. Lancet. 1998;352:9-12.
FULL TEXT
|
ISI
| PUBMED
CiteULike Connotea Del.icio.us Digg Reddit Technorati
What's this?
RELATED LETTERS
Free Fetal DNA in Maternal Circulation
Y. M. Dennis Lo, Rossa W. K. Chiu, K. C. Allen Chan, and Grace T. Y. Chung
JAMA. 2004;292(23):2835.
EXTRACT
| FULL TEXT
Free Fetal DNA in Maternal CirculationReply
Ravinder Dhallan, Michael Cronin, Sarah Emche, Philip Bayliss, and Marian Damewood
JAMA. 2004;292(23):2835-2836.
EXTRACT
| FULL TEXT
RELATED ARTICLES
Microchimerism: An Investigative Frontier in Autoimmunity and Transplantation
Kristina M. Adams and J. Lee Nelson
JAMA. 2004;291(9):1127-1131.
ABSTRACT
| FULL TEXT
Cell-Free Fetal DNA in Maternal Blood: Evolving Clinical Applications
Joe Leigh Simpson and Farideh Bischoff
JAMA. 2004;291(9):1135-1137.
EXTRACT
| FULL TEXT
THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES
 |
Detection of circulating fetal nucleic acids: a review of methods and applications
Hung et al.
J. Clin. Pathol. 2009;62:308-313.
ABSTRACT
| FULL TEXT
The use of cell-free fetal nucleic acids in maternal blood for non-invasive prenatal diagnosis
Wright and Burton
Hum Reprod Update 2009;15:139-151.
ABSTRACT
| FULL TEXT
Noninvasive prenatal diagnosis of monogenic diseases by digital size selection and relative mutation dosage on DNA in maternal plasma
Lun et al.
Proc. Natl. Acad. Sci. USA 2008;105:19920-19925.
ABSTRACT
| FULL TEXT
Microfluidics Digital PCR Reveals a Higher than Expected Fraction of Fetal DNA in Maternal Plasma
Lun et al.
Clin. Chem. 2008;54:1664-1672.
ABSTRACT
| FULL TEXT
Noninvasive Prenatal Diagnosis of Fetal Chromosomal Aneuploidies by Maternal Plasma Nucleic Acid Analysis
Dennis Lo and Chiu
Clin. Chem. 2008;54:461-466.
ABSTRACT
| FULL TEXT
From the Cover: Digital PCR for the molecular detection of fetal chromosomal aneuploidy
Lo et al.
Proc. Natl. Acad. Sci. USA 2007;104:13116-13121.
ABSTRACT
| FULL TEXT
Detrimental Effect of Formaldehyde on Plasma RNA Detection
Chung et al.
Clin. Chem. 2005;51:1074-1076.
FULL TEXT
Recent Advances in Fetal Nucleic Acids in Maternal Plasma
Lo
J. Histochem. Cytochem. 2005;53:293-296.
ABSTRACT
| FULL TEXT
Treatment of Maternal Blood Samples with Formaldehyde Does Not Alter the Proportion of Circulatory Fetal Nucleic Acids (DNA and mRNA) in Maternal Plasma
Chinnapapagari et al.
Clin. Chem. 2005;51:652-655.
FULL TEXT
Lack of Dramatic Enrichment of Fetal DNA in Maternal Plasma by Formaldehyde Treatment
Chung et al.
Clin. Chem. 2005;51:655-658.
FULL TEXT
Detection of Paternally Inherited Fetal Point Mutations for {beta}-Thalassemia Using Size-Fractionated Cell-Free DNA in Maternal Plasma
Li et al.
JAMA 2005;293:843-849.
ABSTRACT
| FULL TEXT
Cell-free fetal DNA in maternal blood: kinetics, source and structure
Bischoff et al.
Hum Reprod Update 2005;11:59-67.
ABSTRACT
| FULL TEXT
Impact of Formaldehyde on the in Vitro Proportion of Fetal DNA in Maternal Plasma and Serum
Benachi et al.
Clin. Chem. 2005;51:242-244.
FULL TEXT
Free Fetal DNA in Maternal Circulation
Lo et al.
JAMA 2004;292:2835-2835.
FULL TEXT
Cell-Free Fetal DNA in Maternal Blood: Evolving Clinical Applications
Simpson and Bischoff
JAMA 2004;291:1135-1137.
FULL TEXT
|